Parental gene:

CBX3, ENSSSCG00000016711

Aliases:None
Description:chromobox homolog 3 [Source:HGNC Symbol;Acc:1553]
Organism:Pig (Sus scrofa)
Coordinates:18:50968277..50979509(-)


>ENSSSCG00000016711
ATGGCCTCCAATAAAACTACATTGCAAAAAATGGGAAAGAAACAAAATGGAAAAAGTAAAAAAGTTGAAGAGGCAGAGCC
TGAAGAATTTGTTGTAGAAAAAGTACTGGACCGACGTGTAGTGAATGGGAAAGTGGAATATTTCCTAAAGTGGAAGGGGT
TTACAGATGCAGACAATACTTGGGAACCTGAAGAAAATTTGGATTGTCCAGAGTTAATTGAAGCATTTCTTAATTCTCAA
AAAGCTGGTAAAGAAAAAGATGGAGCAAAAAGAAAGTCATTATCTGACAGTGAATCTGATGATAGCAAATCAAAGAAGAA
AAGAGATGCTGCTGATAAACCAAGAGGTTTTGCCAGAGGTCTTGATCCAGAACGAATAATTGGTGCCACAGACAGCAGTG
GAGAATTAATGTTTCTCATGAAATGGAAAGATTCAGATGAGGCGGACTTGGTGCTGGCAAAAGAGGCAAATATGAAGTGT
CCTCAAATTGTAATTGCTTTTTATGAAGAGAGGCTAACTTGGCATTCTTGTCCAGAAGATGAAGCTCAATAA

Library Parental gene expression (RPM)
SRP014902_placenta 7 .43 RPM
SRP014902_testis 47 .81 RPM
SRP018856_adipose 16 .27 RPM
SRP018288_kidney 64 .62 RPM
SRP018288_lung 96 .23 RPM
SRP018288_liver 47 .33 RPM
SRP018288_heart 55 .35 RPM
SRP035408_liver 52 .75 RPM
SRP035408_brain 80 .67 RPM



Species Parental gene accession Homology type Retrogenes number
Ailuropoda melanoleuca ENSAMEG00000005969 ortholog_one2many 1 retrogene
Canis familiaris ENSCAFG00000002897 ortholog_one2many 11 retrogenes
Choloepus hoffmanni ENSCHOG00000013843 ortholog_one2one 22 retrogenes
Callithrix jacchus ENSCJAG00000007952 ortholog_one2many 8 retrogenes
Cavia porcellus ENSCPOG00000015168 ortholog_one2many 1 retrogene
Dasypus novemcinctus ENSDNOG00000006250 ortholog_one2one 19 retrogenes
Dipodomys ordii ENSDORG00000005487 ortholog_one2one 11 retrogenes
Equus caballus ENSECAG00000012780 ortholog_one2one 1 retrogene
Felis catus ENSFCAG00000015224 ortholog_one2many 6 retrogenes
Homo sapiens ENSG00000122565 ortholog_one2one 9 retrogenes
Gorilla gorilla ENSGGOG00000025853 ortholog_one2many 6 retrogenes
Loxodonta africana ENSLAFG00000006907 ortholog_one2many 3 retrogenes
Microcebus murinus ENSMICG00000006998 ortholog_one2one 11 retrogenes
Myotis lucifugus ENSMLUG00000007591 ortholog_one2one 2 retrogenes
Mus musculus ENSMUSG00000029836 ortholog_one2many 1 retrogene
Nomascus leucogenys ENSNLEG00000014931 ortholog_one2one 9 retrogenes
Otolemur garnettii ENSOGAG00000016583 ortholog_one2many 1 retrogene
Ochotona princeps ENSOPRG00000011713 ortholog_one2one 9 retrogenes
Procavia capensis ENSPCAG00000004904 ortholog_one2one 2 retrogenes
Pongo abelii ENSPPYG00000017714 ortholog_one2one 10 retrogenes
Pan troglodytes ENSPTRG00000019003 ortholog_one2one 10 retrogenes
Pteropus vampyrus ENSPVAG00000006297 ortholog_one2one 2 retrogenes
Rattus norvegicus ENSRNOG00000011814 ortholog_one2many 2 retrogenes
Sorex araneus ENSSARG00000008011 ortholog_one2one 2 retrogenes
Sarcophilus harrisii ENSSHAG00000017913 ortholog_one2one 1 retrogene
Sus scrofa ENSSSCG00000017529 within_species_paralog 1 retrogene
Ictidomys tridecemlineatus ENSSTOG00000006223 ortholog_one2one 4 retrogenes
Tarsius syrichta ENSTSYG00000008159 ortholog_one2many 6 retrogenes
Tursiops truncatus ENSTTRG00000000711 ortholog_one2one 7 retrogenes

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_sscr_204 83.33 75.41
Please wait, loading
Please wait, loading
Please wait, loading
2. retro_sscr_420 84.86 100.00
Please wait, loading
Please wait, loading
Please wait, loading
3. retro_sscr_755 82.50 86.34
Please wait, loading
Please wait, loading
Please wait, loading
4. retro_sscr_1031 88.62 90.71
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ENSSSCG00000016711 retrocopies