RetrogeneDB ID:

retro_shar_153

Retrocopy
location
Organism:Tasmanian devil (Sarcophilus harrisii)
Coordinates:GL834477.1:1447313..1447672(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:CBX3
Ensembl ID:ENSSHAG00000017913
Aliases:None
Description:chromobox homolog 3 [Source:HGNC Symbol;Acc:1553]


Retrocopy-Parental alignment summary:






>retro_shar_153
ATGGTCTCCAATAAAACTACATTGTAAAAGATGGGAAAGAAACAGAATGGCAAGCATAAGAAAGTATAGGAAGCAGAACC
TGAGGAGCTTATGATGGAGAAGATGTCAGACTAGCAAGTGGGGATGGGAAAGTGGAATTTTTTTTAATGGAAAAGATTTA
AAGAATGCAATAACACATGGGGAATCCAAGGAAAATTAGATTATCCAAAATTAATTGAAACATTTTTGAATGTTGGTAAA
GAAAAAGATGGAACCAAGAAAAAAGAATTTATCTGATTGAGTCAGATGATAGCAAGTCAAAGATAAAATGTGAATCTGCT
AACAAACCACGGGACTTTGATCCAGAGAGAATTATTGGT

ORF - retro_shar_153 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 59.69 %
Parental protein coverage: 69.95 %
Number of stop codons detected: 3
Number of frameshifts detected 1


Retrocopy - Parental Gene Alignment:

ParentalMASNKTTLQKMGKKQNGKSKKVEEAEPEEFVVEKVLDRRVVNGKVEYFLKWKGFTDADNTWEPEENLDCP
M.SNKTTL.KMGKKQNGK.KKV.EAEPEE...EK..D..V..GK......WK.F....NTW.....LD.P
RetrocopyMVSNKTTL*KMGKKQNGKHKKV*EAEPEELMMEKMSD*QVGMGKWXXXX-WKRFKECNNTWGIQGKLDYP
ParentalELIEAFLNSQKAGKEKDGAKR-KSLSDSESDDSKSKKKRESADKPRGFARGLDPERIIG
.LIE.FLN....GKEKDG.K..K.....ESDDSKSK.K.ESA.KPR.F....DPERIIG
RetrocopyKLIETFLN---VGKEKDGTKK<KRIYLIESDDSKSKIKCESANKPRDF----DPERIIG

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Sarcophilus harrisii was not studied using RNA-Seq expression data.
Sarcophilus harrisii was not studied using ChIP-Seq data.
Sarcophilus harrisii was not studied using EST data.
Sarcophilus harrisii was not studied using FANTOM5 data.
retro_shar_153 was not experimentally validated.

Retrocopy orthology:
Sarcophilus harrisii does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 30 parental genes, and 182 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG000000059691 retrocopy
Canis familiaris ENSCAFG0000000289711 retrocopies
Choloepus hoffmanni ENSCHOG0000001384322 retrocopies
Callithrix jacchus ENSCJAG000000079528 retrocopies
Cavia porcellus ENSCPOG000000151681 retrocopy
Dasypus novemcinctus ENSDNOG0000000625019 retrocopies
Dipodomys ordii ENSDORG0000000548711 retrocopies
Equus caballus ENSECAG000000127801 retrocopy
Felis catus ENSFCAG000000152246 retrocopies
Homo sapiens ENSG000001225659 retrocopies
Gorilla gorilla ENSGGOG000000258536 retrocopies
Loxodonta africana ENSLAFG000000069073 retrocopies
Microcebus murinus ENSMICG0000000699811 retrocopies
Myotis lucifugus ENSMLUG000000075912 retrocopies
Mus musculus ENSMUSG000000298361 retrocopy
Nomascus leucogenys ENSNLEG000000149319 retrocopies
Otolemur garnettii ENSOGAG000000165831 retrocopy
Ochotona princeps ENSOPRG000000117139 retrocopies
Procavia capensis ENSPCAG000000049042 retrocopies
Pongo abelii ENSPPYG0000001771410 retrocopies
Pan troglodytes ENSPTRG0000001900310 retrocopies
Pteropus vampyrus ENSPVAG000000062972 retrocopies
Rattus norvegicus ENSRNOG000000118142 retrocopies
Sorex araneus ENSSARG000000080112 retrocopies
Sarcophilus harrisii ENSSHAG000000081921 retrocopy
Sarcophilus harrisii ENSSHAG00000017913 1 retrocopy
retro_shar_153 ,
Sus scrofa ENSSSCG000000167114 retrocopies
Ictidomys tridecemlineatus ENSSTOG000000062234 retrocopies
Tarsius syrichta ENSTSYG000000081596 retrocopies
Tursiops truncatus ENSTTRG000000007117 retrocopies



Copyright © RetrogeneDB 2014-2017