RetrogeneDB ID:

retro_hsap_2332

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:2:155797052..155797478(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000228837
Aliases:None
Status:KNOWN_PSEUDOGENE
Parental gene
information
Parental gene summary:
Parental gene symbol:CBX3
Ensembl ID:ENSG00000122565
Aliases:CBX3, HECH, HP1-GAMMA, HP1Hs-gamma
Description:chromobox homolog 3 [Source:HGNC Symbol;Acc:1553]


Retrocopy-Parental alignment summary:






>retro_hsap_2332
GTAGCAAATAGGAAGCTGGAGTATTTCCCAGAGTGGAAGGGATTTACAAATGCTGACAGTACTTGGGAACCAGAAGACTA
CTTAGAATGTCAAGAGTTAATTGAAACATTTCTTAACTCTCAAAAAGCTGGCAAAGAAAAAGATGATACAAAAAGGAAAT
GTTTATCTGACAGTGAATCTGATGATAGCAAGTCAAAGAAAAGAGATGCTGCTGACAAACCAAGAGGCTTCGCCAGAGGT
CATGATCCAGAAAGAAAAATTGCCACAGAGAGAAGTGGTGAATGGATATTTCTCCTGGAATGGGAATATTCAGATAAGGC
AGACTTGCTGCAGGCAAAAGAGACAAACATGAGGAGTCATCAAATTGTAATTGCTTCTTATGAAGAGCGATTGCCTTGAC
ATTCTTGACGAGAAGATGAAGCTCAA

ORF - retro_hsap_2332 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 73.61 %
Parental protein coverage: 78.69 %
Number of stop codons detected: 2
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalVVNGKVEYFLKWKGFTDADNTWEPEENLDCPELIEAFLNSQKAGKEKDGTKRKSLSDSESDDSKSKKKRD
V.N.K.EYF..WKGFT.AD.TWEPE..L.C.ELIE.FLNSQKAGKEKD.TKRK.LSDSESDDSKSKK.RD
RetrocopyVANRKLEYFPEWKGFTNADSTWEPEDYLECQELIETFLNSQKAGKEKDDTKRKCLSDSESDDSKSKK-RD
ParentalAADKPRGFARGLDPERIIGATDSSGELMFLMKWKDSDEADLVLAKEANMKCPQIVIAFYEERLTWHSCPE
AADKPRGFARG.DPER.I.AT..SGE..FL..W..SD.ADL..AKE.NM...QIVIA.YEERL..HS..E
RetrocopyAADKPRGFARGHDPERKI-ATERSGEWIFLLEWEYSDKADLLQAKETNMRSHQIVIASYEERLP*HS*RE
ParentalDEAQ
DEAQ
RetrocopyDEAQ

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 0 .00 RPM 80 .86 RPM
bodymap2_adrenal 0 .00 RPM 120 .32 RPM
bodymap2_brain 0 .00 RPM 96 .53 RPM
bodymap2_breast 0 .00 RPM 90 .72 RPM
bodymap2_colon 0 .00 RPM 114 .62 RPM
bodymap2_heart 0 .00 RPM 57 .25 RPM
bodymap2_kidney 0 .00 RPM 134 .05 RPM
bodymap2_liver 0 .00 RPM 48 .92 RPM
bodymap2_lung 0 .00 RPM 102 .48 RPM
bodymap2_lymph_node 0 .00 RPM 120 .81 RPM
bodymap2_ovary 0 .00 RPM 121 .93 RPM
bodymap2_prostate 0 .00 RPM 106 .43 RPM
bodymap2_skeletal_muscle 0 .00 RPM 50 .11 RPM
bodymap2_testis 0 .08 RPM 233 .46 RPM
bodymap2_thyroid 0 .00 RPM 103 .27 RPM
bodymap2_white_blood_cells 0 .00 RPM 138 .39 RPM
RNA Polymerase II actvity near the 5' end of retro_hsap_2332 was not detected
No EST(s) were mapped for retro_hsap_2332 retrocopy.
No TSS is located nearby retro_hsap_2332 retrocopy 5' end.
retro_hsap_2332 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_2332 has 2 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Pan troglodytes retro_ptro_1706
Pongo abelii retro_pabe_2112

Parental genes homology:
Parental genes homology involve 11 parental genes, and 67 retrocopies.

Species Parental gene accession Retrocopies number
Choloepus hoffmanni ENSCHOG0000001384322 retrocopies
Cavia porcellus ENSCPOG000000151681 retrocopy
Felis catus ENSFCAG000000152246 retrocopies
Homo sapiens ENSG000000949161 retrocopy
Homo sapiens ENSG000001084683 retrocopies
Homo sapiens ENSG00000122565 9 retrocopies
Nomascus leucogenys ENSNLEG000000149319 retrocopies
Ochotona princeps ENSOPRG000000117139 retrocopies
Sorex araneus ENSSARG000000080112 retrocopies
Sarcophilus harrisii ENSSHAG000000179131 retrocopy
Sus scrofa ENSSSCG000000167114 retrocopies

Expression level across human populations :
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843 No expression ( = 0 RPM ) Legend:


Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM


Indel association:

No indels were associated with its genomic coordinates. Based on Kabza et al. 2015 (PubMed).




Copyright © RetrogeneDB 2014-2017