Parental gene: | FAM60A, ENSCHOG00000007193 |
| Aliases: | None |
| Description: | family with sequence similarity 60, member A [Source:HGNC Symbol;Acc:30702] |
| Organism: | Sloth (Choloepus hoffmanni) |
| Coordinates: | GeneScaffold_3923:219..15923(-) |
>ENSCHOG00000007193
ATGTTTGGTTTTCACAAGCCAAAGATGTACCGAAGTATAGAGGGCTGCTGTATTTGCAGGGCTAAGTCCTCCAGTTCTCG
ATTCACTGACAGTAAACGCTATGAAAAGGACTTCCAGAGCTGCTTTGGGTTACATGAGACTCGTTCAGGAGATATCTGCA
ATGCCTGTGTCTTGCTTGTGAAAAGATGGAAGAAACTGCCAGCAGGATCAAAAAAAAACTGGAATCATGTGGTAGATGCA
AGGGCAGGACCCAGTCTAAAGACTACATTGAAACCAAAGAAAGTGAAAACTCTGTCTGGAAACAGGATAAAAAGCAACCA
GATCAGTAAACTGCAGAAAGAATTTAAACGTCACANNNNNNNNNNNNNNNNNNCCACTTCAAGTGCCTCCCCAGCCCAGT
CTCCTTGTTACAGTAACCAGTCAGATGATGGCTCAGATACCGAGATGGCTTCTGGCTCTAATAGAACACCAGTCTTTTCT
TTTTTAGATCTCACATACTGGAAAAGACAGAAAATATGTTGCGGGATTATCTATAAAGGCCGTTTTGGGGAAGTCCTCAT
TGACACACATCTATTCAAGCCTTGTTGCAGCAATAAGAAAACAACTGCTGAGAAGCCGGAGGAGCAGGGGCCAGAGCCTC
TACCCATCTCCACTCAGGAGTGGTGA
| Species | Parental gene accession | Homology type | Retrogenes number | |
|---|---|---|---|---|
| Bos taurus | ENSBTAG00000001161 | ortholog_one2one | 1 retrogene | |
| Canis familiaris | ENSCAFG00000010685 | ortholog_one2many | 4 retrogenes | |
| Callithrix jacchus | ENSCJAG00000001215 | ortholog_one2many | 3 retrogenes | |
| Felis catus | ENSFCAG00000008955 | ortholog_one2many | 4 retrogenes | |
| Homo sapiens | ENSG00000139146 | ortholog_one2one | 3 retrogenes | |
| Gorilla gorilla | ENSGGOG00000015484 | ortholog_one2one | 3 retrogenes | |
| Myotis lucifugus | ENSMLUG00000009827 | ortholog_one2one | 3 retrogenes | |
| Macaca mulatta | ENSMMUG00000009155 | ortholog_one2one | 2 retrogenes | |
| Mus musculus | ENSMUSG00000039985 | ortholog_one2one | 4 retrogenes | |
| Nomascus leucogenys | ENSNLEG00000016487 | ortholog_one2one | 1 retrogene | |
| Oryctolagus cuniculus | ENSOCUG00000008618 | ortholog_one2one | 1 retrogene | |
| Otolemur garnettii | ENSOGAG00000008927 | ortholog_one2one | 4 retrogenes | |
| Pongo abelii | ENSPPYG00000004396 | ortholog_one2one | 2 retrogenes | |
| Rattus norvegicus | ENSRNOG00000046048 | ortholog_one2many | 1 retrogene | |
| Rattus norvegicus | ENSRNOG00000049943 | ortholog_one2many | 2 retrogenes | |
| Sarcophilus harrisii | ENSSHAG00000006261 | ortholog_one2one | 1 retrogene | |
| Ictidomys tridecemlineatus | ENSSTOG00000007097 | ortholog_one2many | 1 retrogene | |
| Tursiops truncatus | ENSTTRG00000008465 | ortholog_one2one | 3 retrogenes |
| # | RetrogeneDB ID | Identity (%) | Coverage (%) | ORF conservation | Expression evidence | RDV |
|---|---|---|---|---|---|---|
| 1. | retro_chof_109 | 90.54 | 100.00 | Please wait, loading  |
Please wait, loading |
Please wait, loading |
| 2. | retro_chof_453 | 81.63 | 66.52 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 3. | retro_chof_511 | 80.32 | 85.07 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 4. | retro_chof_856 | 83.67 | 66.52 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 5. | retro_chof_979 | 75.33 | 66.52 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 6. | retro_chof_998 | 88.74 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 7. | retro_chof_1108 | 75.36 | 62.44 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 8. | retro_chof_1136 | 71.14 | 66.97 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 9. | retro_chof_1255 | 90.51 | 61.99 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 10. | retro_chof_1614 | 74.50 | 66.97 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 11. | retro_chof_1689 | 68.32 | 71.95 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 12. | retro_chof_1770 | 69.36 | 76.92 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 13. | retro_chof_1971 | 68.22 | 95.48 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 14. | retro_chof_2126 | 80.32 | 85.07 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 15. | retro_chof_2493 | 72.60 | 65.61 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 16. | retro_chof_2576 | 66.44 | 66.97 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 17. | retro_chof_2587 | 79.19 | 66.97 | Please wait, loading |
Please wait, loading |
Please wait, loading |
Download FASTA sequences of all ENSCHOG00000007193 retrocopies