RetrogeneDB ID:

retro_hsap_75

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:18:11851510..11852110(+)
Located in intron of:ENSG00000141404
Retrocopy
information
Ensembl ID:ENSG00000255112
Aliases:CHMP1B, C10orf2, C18-ORF2, C18orf2, CHMP1.5, Vps46-2, Vps46B, hVps46-2
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:CHMP1A
Ensembl ID:ENSG00000131165
Aliases:CHMP1A, CHMP1, PCH8, PCOLN3, PRSM1, VPS46-1, VPS46A
Description:charged multivesicular body protein 1A [Source:HGNC Symbol;Acc:8740]


Retrocopy-Parental alignment summary:






>retro_hsap_75
ATGTCTAACATGGAGAAACACCTGTTCAACCTGAAGTTCGCGGCCAAAGAACTGAGTAGGAGTGCCAAAAAATGCGATAA
GGAGGAAAAGGCCGAAAAGGCCAAAATTAAAAAGGCCATTCAGAAGGGCAACATGGAAGTTGCGAGGATACACGCCGAAA
ATGCCATCCGCCAGAAGAACCAGGCGGTGAATTTCTTGAGAATGAGTGCGCGAGTCGATGCAGTGGCTGCCAGGGTCCAG
ACGGCGGTGACGATGGGCAAGGTGACCAAGTCGATGGCTGGTGTGGTTAAGTCGATGGATGCGACATTGAAGACCATGAA
TCTGGAGAAGATTTCTGCTTTGATGGACAAATTCGAGCACCAGTTTGAGACTCTGGACGTCCAGACGCAGCAAATGGAAG
ACACGATGAGCAGCACGACGACGCTCACCACTCCCCAGAACCAAGTGGATATGCTGCTCCAGGAAATGGCAGATGAGGCG
GGCCTCGACCTCAACATGGAGCTGCCGCAGGGCCAGACCGGCTCCGTGGGCACGAGCGTGGCTTCGGCGGAGCAGGATGA
ACTGTCTCAGAGACTGGCCCGCCTTCGGGATCAAGTGTGA

ORF - retro_hsap_75 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 55.61 %
Parental protein coverage: 100.0 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalMDDTLFQLKFTAKQLEKLAKKAEKDSKAEQAKVKKALLQKNVECARVYAENAIRKKNEGVNWLRMASRVD
M...LF.LKF.AK.L...AKK..K..KAE.AK.KKA....N.E.AR..AENAIR.KN..VN.LRM..RVD
RetrocopyMEKHLFNLKFAAKELSRSAKKCDKEEKAEKAKIKKAIQKGNMEVARIHAENAIRQKNQAVNFLRMSARVD
ParentalAVASKVQTAVTMKGVTKNMAQVTKALDKALSTMDLQKVSSVMDRFEQQVQNLDVHTSVMEDSMSSATTLT
AVA..VQTAVTM..VTK.MA.V.K..D..L.TM.L.K.S..MD.FE.Q...LDV.T..MED.MSS.TTLT
RetrocopyAVAARVQTAVTMGKVTKSMAGVVKSMDATLKTMNLEKISALMDKFEHQFETLDVQTQQMEDTMSSTTTLT
ParentalTPQEQVDSLIMQIAEENGLEVLDQLSQLPEGASAVGESSVRSQEDQLSRRLAALRN
TPQ.QVD.L....A.E.GL.....L.Q...G...VG.S......D.LS.RLA.LR.
RetrocopyTPQNQVDMLLQEMADEAGLDLNMELPQGQTG--SVGTSVASAEQDELSQRLARLRD

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 19 .96 RPM 43 .71 RPM
bodymap2_adrenal 15 .58 RPM 44 .56 RPM
bodymap2_brain 12 .61 RPM 19 .27 RPM
bodymap2_breast 14 .55 RPM 38 .68 RPM
bodymap2_colon 10 .33 RPM 32 .64 RPM
bodymap2_heart 14 .01 RPM 14 .93 RPM
bodymap2_kidney 16 .40 RPM 39 .50 RPM
bodymap2_liver 6 .00 RPM 16 .43 RPM
bodymap2_lung 21 .92 RPM 31 .45 RPM
bodymap2_lymph_node 19 .86 RPM 34 .85 RPM
bodymap2_ovary 10 .60 RPM 46 .77 RPM
bodymap2_prostate 24 .49 RPM 43 .79 RPM
bodymap2_skeletal_muscle 174 .42 RPM 32 .25 RPM
bodymap2_testis 12 .67 RPM 47 .21 RPM
bodymap2_thyroid 64 .69 RPM 46 .76 RPM
bodymap2_white_blood_cells 36 .30 RPM 60 .30 RPM
RNA Polymerase II activity may be related with retro_hsap_75 in 52 libraries
ENCODE library ID Target ChIP-Seq Peak coordinates
ENCFF001VKU POLR2A 18:11851077..11851777
ENCFF002CFW POLR2A 18:11851099..11851621
ENCFF002CFX POLR2A 18:11851107..11851591
ENCFF002CGN POLR2A 18:11851124..11851479
ENCFF002CHO POLR2A 18:11851045..11851674
ENCFF002CIH POLR2A 18:11851328..11851583
ENCFF002CIO POLR2A 18:11851111..11851616
ENCFF002CJE POLR2A 18:11851049..11851671
ENCFF002CJZ POLR2A 18:11850833..11851665
ENCFF002CKX POLR2A 18:11851090..11851577
ENCFF002CLM POLR2A 18:11851129..11851312
ENCFF002CMI POLR2A 18:11851058..11851656
ENCFF002COJ POLR2A 18:11851045..11851481
ENCFF002CPG POLR2A 18:11851122..11851379
ENCFF002CPG POLR2A 18:11851385..11851540
ENCFF002CPH POLR2A 18:11851058..11851448
ENCFF002CQA POLR2A 18:11851059..11851421
ENCFF002CQA POLR2A 18:11851171..11851741
ENCFF002CQC POLR2A 18:11851104..11851574
ENCFF002CQE POLR2A 18:11851087..11851588
ENCFF002CQG POLR2A 18:11851124..11851432
ENCFF002CQG POLR2A 18:11851349..11851561
ENCFF002CQI POLR2A 18:11851098..11851570
ENCFF002CQK POLR2A 18:11851066..11851591
ENCFF002CQM POLR2A 18:11851106..11851606
ENCFF002CQO POLR2A 18:11851088..11851615
ENCFF002CRK POLR2A 18:11850979..11851503
ENCFF002CRO POLR2A 18:11851049..11851469
ENCFF002CSY POLR2A 18:11850838..11852303
ENCFF002CUP POLR2A 18:11851360..11851461
ENCFF002CUQ POLR2A 18:11851109..11851421
ENCFF002CUQ POLR2A 18:11851386..11851588
ENCFF002CUQ POLR2A 18:11850015..11850519
ENCFF002CVF POLR2A 18:11851324..11851617
ENCFF002CVJ POLR2A 18:11850013..11852230
ENCFF002CXM POLR2A 18:11851110..11851408
ENCFF002CXN POLR2A 18:11851101..11851382
ENCFF002CXO POLR2A 18:11851126..11851391
ENCFF002CXO POLR2A 18:11851247..11851671
ENCFF002CXP POLR2A 18:11851082..11851432
ENCFF002CXP POLR2A 18:11851356..11851578
ENCFF002CXR POLR2A 18:11851106..11851579
ENCFF002CZC POLR2A 18:11850601..11852757
ENCFF002CZC POLR2A 18:11850042..11850623
ENCFF002CZD POLR2A 18:11850884..11851832
ENCFF002CZQ POLR2A 18:11851105..11851492
ENCFF002CZQ POLR2A 18:11851105..11851518
ENCFF002CZW POLR2A 18:11850887..11851793
ENCFF002CZY POLR2A 18:11851060..11851610
ENCFF002DAE POLR2A 18:11851106..11851416
ENCFF002DAH POLR2A 18:11851201..11851340
ENCFF002DAK POLR2A 18:11851023..11851523
ENCFF002DAS POLR2A 18:11851181..11851657
ENCFF002DAV POLR2A 18:11851113..11851402
ENCFF002DAV POLR2A 18:11851458..11851596
ENCFF002DAV POLR2A 18:11850055..11850599
ENCFF002DAY POLR2A 18:11851212..11851371
ENCFF002DBB POLR2A 18:11851161..11851361
ENCFF002DBE POLR2A 18:11851104..11851564
ENCFF002DBO POLR2A 18:11851152..11851380
ENCFF002DBO POLR2A 18:11851344..11851565
ENCFF002DBP POLR2A 18:11851164..11851359
ENCFF002DBP POLR2A 18:11851356..11851559
ENCFF002DBQ POLR2A 18:11851165..11851333
ENCFF002DBT POLR2A 18:11851069..11851439
2 EST(s) were mapped to retro_hsap_75 retrocopy
EST ID Start End Identity Match Mis-match Score
BG011449 11851582 11851729 98 144 3 141
R58238 11851491 11851811 99.7 316 1 312


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr ≤ 1 1 < Expr ≤ 5 5 < Expr ≤ 10 Expr > 10
TSS #1 TSS_657951586 libraries 173 libraries 50 libraries 14 libraries 6 libraries
TSS #2 TSS_657961622 libraries 148 libraries 39 libraries 12 libraries 8 libraries
TSS #3 TSS_657971594 libraries 161 libraries 46 libraries 15 libraries 13 libraries
TSS #4 TSS_65800103 libraries 26 libraries 1094 libraries 528 libraries 78 libraries
TSS #5 TSS_6580124 libraries 1 library 45 libraries 185 libraries 1574 libraries
TSS #6 TSS_65802101 libraries 142 libraries 671 libraries 437 libraries 478 libraries
TSS #7 TSS_658031306 libraries 369 libraries 132 libraries 17 libraries 5 libraries

The graphical summary, for retro_hsap_75 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

retro_hsap_75 was not experimentally validated.


Parental genes homology:
Parental genes homology involve 13 parental genes, and 17 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG000000012161 retrocopy
Bos taurus ENSBTAG000000333311 retrocopy
Canis familiaris ENSCAFG000000198221 retrocopy
Callithrix jacchus ENSCJAG000000108261 retrocopy
Homo sapiens ENSG00000131165 2 retrocopies
retro_hsap_359, retro_hsap_75 ,
Macaca mulatta ENSMMUG000000149093 retrocopies
Mustela putorius furoENSMPUG000000072811 retrocopy
Mus musculus ENSMUSG000000007431 retrocopy
Oryctolagus cuniculus ENSOCUG000000233711 retrocopy
Otolemur garnettii ENSOGAG000000048831 retrocopy
Pongo abelii ENSPPYG000000076671 retrocopy
Pan troglodytes ENSPTRG000000084832 retrocopies
Ictidomys tridecemlineatus ENSSTOG000000238131 retrocopy

Expression level across human populations :

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2089

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2112

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2135

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2158

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2181

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2204

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2227

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2250

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2273

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2296

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2325

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2348

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2371

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2394

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2417

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2440

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2463

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2486

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2509

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2532

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2553

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2576

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2599

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2622

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2645

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2668

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2691

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2714

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2737

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2760

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2787

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2810

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2837

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2860

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2887

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2910

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2937

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2960

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2987

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3010

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3122

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3145

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3168

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3191

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3214

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3241

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3264

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3287

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3310

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3333

Notice: Undefined variable: populLEGEND in /home/retrogenedb/www/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM
Could not execute MySQL populData: