RetrogeneDB ID:

retro_chof_1557

Retrocopy
location
Organism:Sloth (Choloepus hoffmanni)
Coordinates:scaffold_324071:673..962(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:TXN
Ensembl ID:ENSCHOG00000011506
Aliases:None
Description:thioredoxin [Source:HGNC Symbol;Acc:12435]


Retrocopy-Parental alignment summary:






>retro_chof_1557
GAAGATTTTCAGGCCACCTTGAAAGATGCTGGAGATAAACCTGTAGTAGTTGATTTCTCAGCCACATGGTGTGGGCCTTG
CAAAATGATCAAGTCTTTCTTCCATTCCCTCTCTGAAAAGTGTAACAAGGTGGTGTTCCTTGAAGTAGATGTGGATGACT
GTCAGGATGTTGCTGCAGAGTGTGAAGTCAAATGCATGCCAACATTTCAGTTTAATAAAATGGGACAAAAGGTGGGAGAA
TTTTGGTGCTAATAAGGAAAAGCTTGAAGCCACCGTTGATGAATTAAGC

ORF - retro_chof_1557 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 79.8 %
Parental protein coverage: 100. %
Number of stop codons detected: 0
Number of frameshifts detected 2


Retrocopy - Parental Gene Alignment:

ParentalEDFKSALEDAGDKLVVVDFSATWCGPCKMIKPFFHSLSEKYSKVVFLEVDVDDCHDVAADCEVKCMPTFQ
EDF...L.DAGDK.VVVDFSATWCGPCKMIK.FFHSLSEK..KVVFLEVDVDDC.DVAA.CEVKCMPTFQ
RetrocopyEDFQATLKDAGDKPVVVDFSATWCGPCKMIKSFFHSLSEKCNKVVFLEVDVDDCQDVAAECEVKCMPTFQ
ParentalFYK-KGQKVG-EFSGANKEKLEATINELS
F.K..G.K.G.E..GANKEKLEAT..ELS
RetrocopyFNK<NGTKGG<ENFGANKEKLEATVDELS

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Choloepus hoffmanni was not studied using RNA-Seq expression data.
Choloepus hoffmanni was not studied using ChIP-Seq data.
Choloepus hoffmanni was not studied using EST data.
Choloepus hoffmanni was not studied using FANTOM5 data.
retro_chof_1557 was not experimentally validated.

Retrocopy orthology:
Choloepus hoffmanni does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 33 parental genes, and 141 retrocopies.

Species Parental gene accession Retrocopies number
Anolis carolinensis ENSACAG000000130183 retrocopies
Ailuropoda melanoleuca ENSAMEG000000180173 retrocopies
Bos taurus ENSBTAG000000029532 retrocopies
Choloepus hoffmanni ENSCHOG000000102621 retrocopy
Choloepus hoffmanni ENSCHOG00000011506 10 retrocopies
Callithrix jacchus ENSCJAG000000173215 retrocopies
Cavia porcellus ENSCPOG000000153485 retrocopies
Dasypus novemcinctus ENSDNOG0000001920520 retrocopies
Equus caballus ENSECAG000000133241 retrocopy
Echinops telfairi ENSETEG0000000306513 retrocopies
Felis catus ENSFCAG000000047904 retrocopies
Homo sapiens ENSG000001368107 retrocopies
Gorilla gorilla ENSGGOG000000069256 retrocopies
Loxodonta africana ENSLAFG000000128562 retrocopies
Macropus eugenii ENSMEUG000000035158 retrocopies
Microcebus murinus ENSMICG000000021282 retrocopies
Myotis lucifugus ENSMLUG000000090653 retrocopies
Macaca mulatta ENSMMUG000000103221 retrocopy
Mustela putorius furoENSMPUG000000074263 retrocopies
Mus musculus ENSMUSG000000283672 retrocopies
Otolemur garnettii ENSOGAG000000091656 retrocopies
Ochotona princeps ENSOPRG0000001380511 retrocopies
Procavia capensis ENSPCAG000000140111 retrocopy
Pongo abelii ENSPPYG000000194912 retrocopies
Pan troglodytes ENSPTRG000000212457 retrocopies
Pteropus vampyrus ENSPVAG000000072651 retrocopy
Rattus norvegicus ENSRNOG000000120811 retrocopy
Sorex araneus ENSSARG000000074652 retrocopies
Sarcophilus harrisii ENSSHAG000000067391 retrocopy
Sus scrofa ENSSSCG000000054531 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000206684 retrocopies
Tupaia belangeri ENSTBEG000000111932 retrocopies
Tursiops truncatus ENSTTRG000000001191 retrocopy



Copyright © RetrogeneDB 2014-2017