RetrogeneDB ID:

retro_chof_1166

Retrocopy
location
Organism:Sloth (Choloepus hoffmanni)
Coordinates:scaffold_21634:12206..12677(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:BTF3
Ensembl ID:ENSCHOG00000001861
Aliases:None
Description:basic transcription factor 3 [Source:HGNC Symbol;Acc:1125]


Retrocopy-Parental alignment summary:






>retro_chof_1166
ATGAATCAAGAAAAGTTAGCCAAACTTCAGGCTCAGGTCCAGATAGGCGCAAGGGTACAGCTCACAGAAAGAAGGTAGTA
CATAGAACAGCTACAGCTGATGACAAAAAGCTTCAGAGTTCTCTAAAAAAAACTGGTTTTGAACAATATAGCTGGTATTG
AAGAGGTGAATATGATTAAAGATGATGGGACAGTTATTCATTTCAACAATCCAAAGGTCCAAGCTTCCCTCTCTGTTAAC
ACCTTTGCAATTACCAGTCATGCAGAAGCCAAACCAATCACAGAAACGCTCCCTGGAATGTTAAGTCAGCTTGATGCTGA
CAGCTTAACAAGCCTTAGGAAGTTAGCTGAACAGTTCCCCCTGCAAGGGTTGGATAACAAAGCAGCAAAACCAGAAGACA
TTGATGAAGAGGAGGATGATGTTCCAGATCTCGTAGAAAATTTTGATGAGACGTCAAAGAATGAAGCTAAC

ORF - retro_chof_1166 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 70. %
Parental protein coverage: 76.21 %
Number of stop codons detected: 0
Number of frameshifts detected 2


Retrocopy - Parental Gene Alignment:

ParentalMNQEKLAKLQAQVRIGG-KGTARRKKKVVHRTATADDKKLQFSLKKLG-VNNISGIEEVNMFTNQGTVIH
MNQEKLAKLQAQV.IG..KGTA.RKK.VVHRTATADDKKLQ.S....G..NNI.GIEEVNM....GTVIH
RetrocopyMNQEKLAKLQAQVQIGA<KGTAHRKK-VVHRTATADDKKLQSSXXXXG>LNNIAGIEEVNMIKDDGTVIH
ParentalFNNPKVQASLAANTFTITGHAETKQLTEMLPSILNQLGADSLTSLRRLAEALPKQSVDGKAPLATG-EDD
FNNPKVQASL..NTF.IT.HAE.K..TE.LP..L.QL.ADSLTSLR.LAE..P.Q..D.KA.........
RetrocopyFNNPKVQASLSVNTFAITSHAEAKPITETLPGMLSQLDADSLTSLRKLAEQFPLQGLDNKAAKPEDIDEE
ParentalDDEVPDLVENFDEASKNEAN
.D.VPDLVENFDE.SKNEAN
RetrocopyEDDVPDLVENFDETSKNEAN

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Choloepus hoffmanni was not studied using RNA-Seq expression data.
Choloepus hoffmanni was not studied using ChIP-Seq data.
Choloepus hoffmanni was not studied using EST data.
Choloepus hoffmanni was not studied using FANTOM5 data.
retro_chof_1166 was not experimentally validated.

Retrocopy orthology:
Choloepus hoffmanni does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 19 parental genes, and 152 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG0000001156314 retrocopies
Choloepus hoffmanni ENSCHOG00000001861 13 retrocopies
Callithrix jacchus ENSCJAG000000166004 retrocopies
Cavia porcellus ENSCPOG000000128321 retrocopy
Ciona savignyi ENSCSAVG000000096531 retrocopy
Dasypus novemcinctus ENSDNOG000000186824 retrocopies
Felis catus ENSFCAG0000002397310 retrocopies
Homo sapiens ENSG0000014574111 retrocopies
Myotis lucifugus ENSMLUG0000001291211 retrocopies
Macaca mulatta ENSMMUG000000222912 retrocopies
Monodelphis domestica ENSMODG000000017623 retrocopies
Mustela putorius furoENSMPUG0000000586428 retrocopies
Mus musculus ENSMUSG0000002166011 retrocopies
Pan troglodytes ENSPTRG0000001697912 retrocopies
Pteropus vampyrus ENSPVAG0000000716011 retrocopies
Sorex araneus ENSSARG000000077365 retrocopies
Tarsius syrichta ENSTSYG000000012957 retrocopies
Tursiops truncatus ENSTTRG000000072902 retrocopies
Vicugna pacos ENSVPAG000000096072 retrocopies



Copyright © RetrogeneDB 2014-2017