Parental gene:

ONIVA08G11780

Aliases:None
Description:None
Organism:Indian wild rice (Oryza nivara)
Coordinates:8:12793905..12804280(-)


>ONIVA08G11780
ATGGCGAGCGACGGGCAGCTCAGGGACTGGGTCTCCGACAAGCTCATGTCCCTCCTCGGCTACTCCAAGAGCGTCGTCGT
GCAGTACGTCATCAGGCTGGCGAAGGAGTGCTCTTCCACCGGCGACCTCGTGGGGAAGCTCGTCGAATTTGGGTTCACGT
CCTCCGCGGAGACCCGGAGCTTCGCCGCGGACATCTACGCCAAGGTTCCCAGGAAGGCCAGCGGTATCAGCAATTACCAG
AAACAGGAAAGAGAGGCAGCAAAGCTTGTGAAGAAACAGAGCACTTACAAACTGTTGGCTGATGAGGAGGACAACGATGC
TGAAACCATCACATCGACGAGTCGACAGAGCTCTGCGAGTACATCCTCTAAGAGTAGAAAGCATTTTAGGAGGAAAGCTG
AAGACCAGGACGATGGGAATGATGATGATGAAACAAAAATAAAACAGGATTCTGGGAGGAATGTGAAAAGACGAACAGAA
GAGGTGGATGATGAAGATGATGGTAATGATACTGATGAAGAGCAAGAAAGGATAAGAGATCAGCAGGAAAGAGCTCAGCT
AGAAAAAAACATGAGAGAAAGAGATGCAGCCAACACTCGAAAGTTGATGGAGCGACAGTTATCTAAGGAGGAACAAGAGG
AGATCACCAGGAGATCTCAAGCAATGGACAAGAATGACACTTCAGATCTGAGAAAATTTTCAAGGCAAGCCTACTTACAG
AAGAGAAGGGACAAAAAAATCGATGAGATCAGGGATGAAATTCTAGATCATGAGTACATTTTTCAGGATGTGAAACTAAC
TGAAGCAGAAGAAAAGGAGTTCAGATACAAAAAGAAGATTTATGATCTTGTGAAGGAGCATGTTGAGAGTGCAGATGATG
TTGCTGAGTACAAAATGCCTGAAGCTTATGACATGGGTGACAGTGTCAATCAAGAAAAGAGATTCTCTGTAGCAATGCAG
CGTTACAAAGATCCTGAGGCCAGGGATAAAATGAATCCTTTTGCTGAACAAGAAGCATGGGAAGAGCACCAAATAGGAAA
GTCTAAACTGCAATTTGGATCAAAAGATAGGAAGCGGTCTTCTGATGATTATCAGTATGTATTCGAAGATGGCATTGATT
TTGTTAAATCTTCAGTCATAGAAGGAACGCAGCATGAAGAAGACTCAGATCAAGAGGATATCGATGAAAAGGATATGTTA
AAAAGGGAGCTCCAGGATGAGCGTAAAACTCTTCCAATCTATAAATTCAGGGATGAACTGCTCAAGGCTGTTGAAGAGTA
TCAGGTTATTGTCATAGTAGGAGAAACTGGCTCTGGTAAAACAACACAAATACCTCAATATCTTCATGAAGCTGGATATA
CAGCAAAAGGAAAGGTGGCATGTACACAACCTCGTCGAGTTGCAGCAATGAGTGTTGCAGCGAGGGTGTCCCAAGAGATG
GGTGTTAAACTAGGACATGAGGTTGGCTACTCTATAAGGTTTGAGGATTGCACGTCTGAGAAAACATTGATTAAGTATAT
GACTGATGGCATGCTTCTGAGGGAGTTTCTTGGCGAACCAGATTTGGCAAGCTATAGTGTTGTTATGGTTGATGAGGCTC
ATGAGCGTACACTGTCTACTGATATCTTATTTGGTTTGGTGAAGGATATTTCACGGTTTCGACCAGATCTAAAGTTGCTC
ATTTCAAGTGCAACCCTTGATGCAGAAAAATTTAGTGACTACTTTGATTCAGCTCCTATTTTCAAGATACCTGGGAGGCG
ATATCCTGTTGAAGTTCATTATACAAAAGCTCCAGAAGCAGATTATATAGATGCAGCCATTGTCACTGTTTTGCAGATAC
ATGTGACGCAACCCCCTGGTGATATTCTTGTATTCCTTACAGGACAAGAAGAAATTGAAACAATTGATGAAATCCTTAAA
CACAGAACAAGAGGCTTAGGCACAAAGATTGCAGAACTACTTATCTGTCCTATATATGCAAATCTGCCAACTGAACTTCA
AGCTAAGATATTTGAGCCCACCCCAGAGGGTGCTCGGAAGGTTGTTCTGGCCACTAATATAGCAGAGACTTCATTGACCA
TTGATGGTATAAAGTATGTCGTTGATCCAGGGTTTTGTAAGATCAAGTCATACAATCCCCGAACAGGGATGGAATCTCTA
CTTATCAACCCTATCTCAAAGGCATCAGCAAACCAGAGGGCAGGAAGATCTGGACGCACTGGACCAGGAAAATGCTTCCG
CCTGTACACAAGTTATAATTACATGCATGACCTTGAGGATAATACTGTTCCAGAGATTCAAAGAACCAACCTTGCAAATG
TTGTGCTTACACTTAAGAGTCTTGGTATTCATGACTTGGTTAACTTTGATTTTATGGATCCACCTCCATCAGAGGCTCTA
TTAAAGGCCCTGGAACAACTCTTTGCTCTCAGTGCACTCAACAGTCGTGGAGAATTGACCAAGACTGGCAGAAGAATGGC
AGAGTTTCCATTGGACCCTATGTTGTCAAAGATGATAGTAGCTTCAGAGAAATATAAGTGCTCTGATGAGGTCATCTCCA
TTGCATCCATGTTGTCAGTTGGCAATTCTATATTCTATCGTCCAAAGGATAAACAAGTGCATGCAGACAATGCAAGGTTG
AACTTCCACACTGGCAATGTTGGGGATCATATAGCTCTACTCAATGTTTACAACTCATGGAAAGAAACAGACTATTCAAC
ACAGTGGTGCTATGAAAACTATATACAGGTCCGCAGCATGAAGAGAGCAAGAGATATTCGTGATCAACTGGAGGGACTTC
TAGAAAGAGTTGAGATTGAGATTTCTTCAAATGCCAGCGATTTGGATGCTATTAAAAAGGCTATAACATCAGGTTTCTTC
CATCATTCTTCACGGTTGCAGAAGAATGGTTCATATAGAACTGTTAAGAACCCTCAAACTGTAACGGAACTGAAGCCCGA
CTGGCTGGTAGAAATAGCGCCACACTATTATCAACTAAAAGACGTTGACGACACTGGGACTAAGAAGCTGCCTAAGGGCC
AAGGACGAGCTGCATTGTAA

Species Parental gene accession Homology type Retrogenes number
Oryza sativa indica BGIOSGA027162 ortholog_one2one 1 retrogene
Brassica oleracea Bo5g087070 ortholog_many2many 1 retrogene
Brassica rapa Bra010168 ortholog_many2many 1 retrogene
Brachypodium distachyon BRADI1G61220 ortholog_one2one 1 retrogene
Glycine max GLYMA06G21821 ortholog_many2many 1 retrogene
Leersia perrieri LPERR08G09260 ortholog_one2one 1 retrogene
Hordeum vulgare MLOC_5589 ortholog_one2one 1 retrogene
Oryza meridionalis OMERI08G09070 ortholog_one2one 1 retrogene
Oryza punctata OPUNC08G10350 ortholog_one2one 1 retrogene
Oryza glaberrima ORGLA08G0098600 ortholog_one2one 1 retrogene
Oryza rufipogon ORUFI08G12410 ortholog_one2one 1 retrogene
Solanum tuberosum PGSC0003DMG402024649 ortholog_many2many 1 retrogene
Prunus persica PRUPE_ppa000714mg ortholog_many2many 1 retrogene
Sorghum bicolor Sb04g022460 ortholog_one2many 1 retrogene
Setaria italica Si021302m.g ortholog_one2one 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_oniv_26 76.08 58.49
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ONIVA08G11780 retrocopies