RetrogeneDB ID:

retro_oniv_26

Retrocopy
location
Organism:Indian wild rice (Oryza nivara)
Coordinates:5:16515652..16518865(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:ONIVA05G15510
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ONIVA08G11780
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_oniv_26
ATGGCGGCGAGCGATGATGGCCAGCTCAGGACGTGGGTCTCCGACCGCCTCATGGCGCTCCTCGGATACTCCCAGGGCCT
CGTGGCGCGGCTCGTCGTCCGCCTCGCGCGGGAGTGCGCCTCCGCGGGTGACCTCGCGGCGCGGCTCGTCGACCTCGCCG
GGTTCCCGCCTTCCCCCGACACCGCCGCGTTCGCCGAGGACGTGTACGGGAGGGTGCCCCGCAGTTGCGGCGGCGGCGGC
GACGACGCCGGGGTCAGCGAGTACCAGAGGCAGATGCAGGAGGCTGCGGCGATGGCCAAGAAGCAGAGCACCATCAAGCT
GCTCGACGACGACGGCGAGATCGGCGTTTCCGCGTCGCCCTCCAGCGGCGGCAGGAAGCGTTTCAGGAGGAAGGCCGTGG
GCGAAGACGATGACAATGCCGGACGGAACGCGCGACGGCGGCGTAGCCCGGACGACGAGGAGGAGGACGGCGACGCCGGC
GAGGAAGAAGAGATGGAGCGGGATCAGATCGATAGGGCGCAGCTCGAGCGGAACATCAGGGAGCGCGACGCGGCGAGCAC
GAGGAGGCTGACGGATCGGAAGACGACCAAGCGGGAGCAGGGCGAGCTCGCGCGCCGGTCGGACGCCATGGACAAGAACG
ACACCTCGGGGCTCAGGAGGCTCTCCCGGCGCGCGTACCTGCAGAGGCGGAAGGAGAAGAAGGTCGAGGAGATGCGCGAC
GAGATCGTCGACCACGAGTTCCTCTTCCCCGGCGTCCAGCTGACGGCCGCCGAGGAGAGGGACATGAGGCACAAGAAGCA
AGTCTACGGCCTCGTGCACGATCGCGACGACTACTACAGAATGCCGGACGCCTACGACGCCGCCGCGAACGTCGATCAGG
AGACGAGGTTCTCGGTGGCGCGGCGGCGGTACGAGGAGCCAGCTGAGGCGGCGAGGGACGGCAAGACGGCGAACGCCTTG
TCCGAGCAGGAGGCCTGGGAGGAGCAGCAGATACGGAAGTCGAGGCTGCAGTTCGGATCCATGGATCGCGGCCGGCGCGG
CGACGAGTACGAGCTCCTGTTCGACGACGGCGTCGAGTTCGTCAGGTCGACGGTGATGGCGGGCACCGCGCCTGCAGACG
ACGACGACACGGCGGCGGCGGCGGCGGCCGACGAGTACCATGCCGAGGCCATGGATGCCAAGGCCACGTTACAAGACGAG
AGGAAGACTCTCCCGGTGTACAAGCTCAAGGACGACCTGCTCAAGGCCATCGACGAGCACCAGGTCCTGATCGTCGTCGG
CGAGACCGGCTCCGGCAAGACGACGCAGATACCGCAGTACCTCCACGAGGTCGGGTACACGGCGGGGGGGAGGAAGAAGG
TGGCGTGCACGCAGCCGCGGCGCGTGGCGGCGATGAGCGTGGCGGCGAGGGTGGCGGAGGAGATGGGCGTCAAGCTCGGG
CACGAGGTCGGCTACTCCATCCGGTTCGAGGACTGCACGTCGGAGAAGACGGTGATCAAGTACATGACCGACGGGATGCT
CCTCCGCGAGTTCCTCGGCGAGCCCGACCTGGGCAGCTACAGCGTCGTCGTCGTCGACGAGGCCCACGAGCGGACGCTCG
CCACCGACATCCTCTTCGGCCTCGTCAAGGACATCGCCCGCCTCCGCCCTGACATGAAGCTGCTCATTTCCAGCGCGACG
CTCAACGCCGACAAGTTCAGCGACTTCTTCGACGCGGCGCCCGTCTTCCGGATCCCCGGGCGGCGGTTCGAGGTGGGCAT
CCACTACACCGTGGCGCCGGAGGCGGACTACATCGACGCCGCCGTCGTGACGGTGCTGCAGCTGCACGTCACGGAGCCCC
CCGGCGGCGGCGACATCCTGCTGTTCCTCACGGGGCAGGAGGAGATCGAGACGGTGGAGGAGATCCTGAGGCATCGGCTG
CGGGTGCTCGGCGGCAAGGTGGCGGAGCTGGTGATCTGCCCCATCTACGCCAACCTCCCCGCCGAGCTGCAGGCCAAGAT
CTTCGAGCCGGCGCCGGCGGGCGCGCGCAAGGTGGTGCTCGCCACCAACATCGCCGAGACGTCGCTGACCATCGACGGGA
TCAAGTACGTGGTCGACCCGGGGTTCTGCAAGGTGAAGTCGTACAACCCGCGCACCGGGATGGAGTCGCTGGTGGTGGCG
CCGGTGTCGAGGGCGTCGGCGGAGCAGCGCGCCGGCCGGTCGGGGCGCACCGGGCCGGGCGAGTGCTTCCGGCTCTACAC
GGAGTACAACTTCGTCAGCGACCTCGACGACGACGCGGTGCCGGAGATCCAGCGGAGCAACCTCGCCAGCGTCGTGCTGG
CGCTCAAGGCGCTCGGGATCAACGACCTCGTCGGCTTCGACTTCATGGACCCGCCGCCGGCGGAGTCGCTGCTCAGGGCG
CTGGAGGAGCTCTTCGCCCTCGGCGCGCTCAACAGCCGCGGCGAGCTCACCAAGACCGGGAGGAGGATGGCGGAGTTCCC
CCTGGACCCCATGCTCTCCAAGGCCATCGTCGCGTCGGAGAGGTACGGGTGCTCCGAGGAGGTGATCACCATCGCGGCCA
TGCTGTCCGCCGGGAACGCCGTCTTCTACCGCCCAAGGGACAAGCGGGTCCACGCCGACGCCGCACGGCGGGCGTTCCAC
GCCGGCAACGCCGGCGACCACGTCGCGCTGCTCAACGTGTACAACGCGTGGGCGGAGTCCGGCTACTCGCCGCAGTGGTG
CCGCGAGAGCTTCGTGCAGCACCGCACCATGCGGCGCGCGCGGGACGTGCGGGACCAGCTGGGGGCGCTGCTTGAGCGGG
TGGAGATCGCGCCGTGCTCCTCCGCCGGCGGCGGCGACCTCGACGCGGTCAGGAAGGCGGTCACGGCGGGCTACTTCCGC
CACGCTGCGCGGCTGCAGAGGGACGGGTCGTACCGCGCCGTGAAGAGCCGGCAGACGGTGTTCGTCCACCCGAGCTCCGG
GCTGGCGCAGGCGCCGCCGCGGTGGGCGTTGTACCACGAGCTGGTGCTCACGACCAAGGAGTACATGAGGCAGGTGACGG
AGCTCAAGCCGGAGTGGCTGGTGGAGATCGCGCCGCACTACTACGAGCGCAAGGACGTCGACGAGCCTGAGCCCAAGAAG
ACGGCGGCGGCGGCTACGCCGCAAGAGCAGACGACGGCCGGCTCTACACCAACGAAGCAGACTCCGAATCTGAATAGTTT
CTTCGACGTGTAA

ORF - retro_oniv_26 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 76.08 %
Parental protein coverage: 58.49 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalKRELQDERKTLPIYKFRDELLKAVEEYQVIVIVGETGSGKTTQIPQYLHEAGYTAKG--KVACTQPRRVA
K..LQDERKTLP.YK..D.LLKA..E.QV...VGETGSGKTTQIPQYLHE.GYTA.G..KVACTQPRRVA
RetrocopyKATLQDERKTLPVYKLKDDLLKAIDEHQVLIVVGETGSGKTTQIPQYLHEVGYTAGGRKKVACTQPRRVA
ParentalAMSVAARVSQEMGVKLGHEVGYSIRFEDCTSEKTLIKYMTDGMLLREFLGEPDLASYSVVMVDEAHERTL
AMSVAARV..EMGVKLGHEVGYSIRFEDCTSEKT.IKYMTDGMLLREFLGEPDL.SYSVV.VDEAHERTL
RetrocopyAMSVAARVAEEMGVKLGHEVGYSIRFEDCTSEKTVIKYMTDGMLLREFLGEPDLGSYSVVVVDEAHERTL
ParentalSTDILFGLVKDISRFRPDLKLLISSATLDAEKFSDYFDSAPIFKIPGRRYPVEVHYTKAPEADYIDAAIV
.TDILFGLVKDI.R.RPD.KLLISSATL.A.KFSD.FD.AP.F.IPGRR..V..HYT.APEADYIDAA.V
RetrocopyATDILFGLVKDIARLRPDMKLLISSATLNADKFSDFFDAAPVFRIPGRRFEVGIHYTVAPEADYIDAAVV
ParentalTVLQIHVTQPPG--DILVFLTGQEEIETIDEILKHRTRGLGTKIAELLICPIYANLPTELQAKIFEPTPE
TVLQ.HVT.PPG..DIL.FLTGQEEIET..EIL.HR.R.LG.K.AEL.ICPIYANLP.ELQAKIFEP.P.
RetrocopyTVLQLHVTEPPGGGDILLFLTGQEEIETVEEILRHRLRVLGGKVAELVICPIYANLPAELQAKIFEPAPA
ParentalGARKVVLATNIAETSLTIDGIKYVVDPGFCKIKSYNPRTGMESLLINPISKASANQRAGRSGRTGPGKCF
GARKVVLATNIAETSLTIDGIKYVVDPGFCK.KSYNPRTGMESL...P.S.ASA.QRAGRSGRTGPG.CF
RetrocopyGARKVVLATNIAETSLTIDGIKYVVDPGFCKVKSYNPRTGMESLVVAPVSRASAEQRAGRSGRTGPGECF
ParentalRLYTSYNYMHDLEDNTVPEIQRTNLANVVLTLKSLGIHDLVNFDFMDPPPSEALLKALEQLFALSALNSR
RLYT.YN...DL.D..VPEIQR.NLA.VVL.LK.LGI.DLV.FDFMDPPP.E.LL.ALE.LFAL.ALNSR
RetrocopyRLYTEYNFVSDLDDDAVPEIQRSNLASVVLALKALGINDLVGFDFMDPPPAESLLRALEELFALGALNSR
ParentalGELTKTGRRMAEFPLDPMLSKMIVASEKYKCSDEVISIASMLSVGNSIFYRPKDKQVHADNARLNFHTGN
GELTKTGRRMAEFPLDPMLSK.IVASE.Y.CS.EVI.IA.MLS.GN..FYRP.DK.VHAD.AR..FH.GN
RetrocopyGELTKTGRRMAEFPLDPMLSKAIVASERYGCSEEVITIAAMLSAGNAVFYRPRDKRVHADAARRAFHAGN
ParentalVGDHIALLNVYNSWKETDYSTQWCYENYIQVRSMKRARDIRDQLEGLLERVEIEISSNA--SDLDAIKKA
.GDH.ALLNVYN.W.E..YS.QWC.E...Q.R.M.RARD.RDQL..LLERVEI...S.A...DLDA..KA
RetrocopyAGDHVALLNVYNAWAESGYSPQWCRESFVQHRTMRRARDVRDQLGALLERVEIAPCSSAGGGDLDAVRKA
ParentalITSGFFHHSSRLQKNGSYRTVKNPQTVTELKPDWLVEIAPHY
.T.G.F.H..RLQ..GSYR.VK..QTV.......L....P..
RetrocopyVTAGYFRHAARLQRDGSYRAVKSRQTVFVHPSSGLAQAPPRW

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza nivara was not studied using RNA-Seq expression data.
Oryza nivara was not studied using ChIP-Seq data.
Oryza nivara was not studied using EST data.
Oryza nivara was not studied using FANTOM5 data.
retro_oniv_26 was not experimentally validated.

Retrocopy orthology:
Oryza nivara does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 16 parental genes, and 16 retrocopies.

Species Parental gene accession Retrocopies number
Oryza sativa indicaBGIOSGA0271621 retrocopy
Brassica oleracea Bo5g0870701 retrocopy
Brassica rapa Bra0101681 retrocopy
Brachypodium distachyon BRADI1G612201 retrocopy
Glycine max GLYMA06G218211 retrocopy
Leersia perrieri LPERR08G092601 retrocopy
Hordeum vulgare MLOC_55891 retrocopy
Oryza meridionalis OMERI08G090701 retrocopy
Oryza nivara ONIVA08G11780 1 retrocopy
retro_oniv_26 ,
Oryza punctata OPUNC08G103501 retrocopy
Oryza glaberrima ORGLA08G00986001 retrocopy
Oryza rufipogon ORUFI08G124101 retrocopy
Solanum tuberosum PGSC0003DMG4020246491 retrocopy
Prunus persica PRUPE_ppa000714mg1 retrocopy
Sorghum bicolor Sb04g0224601 retrocopy
Setaria italica Si021302m.g1 retrocopy



Copyright © RetrogeneDB 2014-2017