RetrogeneDB ID:

retro_hsap_12

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:14:61746809..61747865(-)
Located in intron of:ENSG00000027075
Retrocopy
information
Ensembl ID:ENSG00000182107
Aliases:TMEM30B, CDC50B
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:TMEM30A
Ensembl ID:ENSG00000112697
Aliases:TMEM30A, C6orf67, CDC50A
Description:transmembrane protein 30A [Source:HGNC Symbol;Acc:16667]


Retrocopy-Parental alignment summary:






>retro_hsap_12
ATGACCTGGAGCGCCACGGCCCGGGGCGCCCACCAGCCCGACAACACCGCCTTCACTCAGCAGCGCCTCCCCGCCTGGCA
GCCGCTGCTGTCGGCCAGCATCGCGCTGCCGCTCTTCTTCTGCGCGGGCCTGGCCTTCATCGGCCTGGGCCTGGGCCTCT
ACTACTCCTCCAACGGCATCAAGGAGCTGGAGTACGACTATACAGGCGACCCGGGCACCGGTAACTGCTCGGTGTGCGCC
GCGGCTGGCCAGGGCCGGGCGCTGCCGCCCCCCTGCTCGTGCGCCTGGTACTTCTCGCTGCCCGAGCTCTTCCAGGGCCC
AGTGTACCTCTACTACGAGCTGACCAACTTCTACCAGAACAACCGGCGCTACGGCGTGTCCCGCGACGACGCGCAGCTGA
GCGGACTCCCCAGCGCGCTGCGCCACCCTGTCAACGAGTGCGCCCCCTACCAGCGCAGCGCGGCCGGCCTGCCCATCGCG
CCCTGCGGCGCCATCGCCAACAGCCTCTTCAACGACTCCTTCTCGCTTTGGCACCAGCGCCAGCCCGGCGGGCCCTACGT
CGAGGTGCCGCTCGACCGCTCCGGCATCGCCTGGTGGACCGACTACCACGTCAAGTTCCGCAACCCGCCGCTGGTCAACG
GCAGCCTGGCGTTGGCCTTCCAGGGCACGGCGCCCCCGCCCAACTGGCGCCGGCCAGTCTACGAGCTCAGCCCCGACCCC
AACAACACCGGCTTCATCAATCAGGACTTCGTGGTGTGGATGCGCACGGCGGCGCTGCCCACGTTCCGCAAACTGTACGC
GCGCATCCGCCAGGGCAACTACTCGGCCGGGCTGCCGCGGGGCGCCTACCGCGTCAACATCACCTACAACTACCCGGTGC
GCGCGTTCGGCGGCCACAAGCTCCTCATCTTCAGCAGCATCTCGTGGATGGGTGGCAAGAACCCCTTCCTGGGCATCGCC
TACCTGGTCGTCGGCTCCCTCTGCATCCTCACCGGCTTTGTCATGCTGGTCGTCTACATTCGCTACCAGGACCAGGACGA
CGACGACGAGGAGTGA

ORF - retro_hsap_12 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 55.43 %
Parental protein coverage: 70.64 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalPCFCTINFTLEKSFEGNVFMYYGLSNFYQNHRRYVKSRDDSQLNGDSSALLNPSKECEPYRRNE-DKPIA
PC.C...F.L...F.G.V..YY.L.NFYQN.RRY..SRDD.QL.G..SAL..P..EC.PY.R.....PIA
RetrocopyPCSCAWYFSLPELFQGPVYLYYELTNFYQNNRRYGVSRDDAQLSGLPSALRHPVNECAPYQRSAAGLPIA
ParentalPCGAIANSMFNDTLELFLIGNDSYP-IPIALKKKGIAWWTDKNVKFRNPP-GGDNLEERFKGTTKPVNWL
PCGAIANS.FND...L........P.....L...GIAWWTD..VKFRNPP.....L...F.GT..P.NW.
RetrocopyPCGAIANSLFNDSFSLWHQRQPGGPYVEVPLDRSGIAWWTDYHVKFRNPPLVNGSLALAFQGTAPPPNWR
ParentalKPVYMLDSDPDNNGFINEDFIVWMRTAALPTFRKLYRLIERKSDLHPTLPAGRYSLNVTYNYPVHYFDGR
.PVY.L..DP.N.GFIN.DF.VWMRTAALPTFRKLY..I.R.......LP.G.Y..N.TYNYPV..F.G.
RetrocopyRPVYELSPDPNNTGFINQDFVVWMRTAALPTFRKLYARI-RQGNYSAGLPRGAYRVNITYNYPVRAFGGH
ParentalKRMILSTISWMGGKNPFLGIAYIAVGSISFLLGVVLLVINHKYRNSSN
K..I.S.ISWMGGKNPFLGIAY..VGS...L.G.V.LV....Y.....
RetrocopyKLLIFSSISWMGGKNPFLGIAYLVVGSLCILTGFVMLVVYIRYQDQDD

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 0 .99 RPM 263 .12 RPM
bodymap2_adrenal 0 .80 RPM 269 .64 RPM
bodymap2_brain 0 .09 RPM 478 .86 RPM
bodymap2_breast 1 .23 RPM 232 .10 RPM
bodymap2_colon 1 .30 RPM 302 .78 RPM
bodymap2_heart 0 .04 RPM 108 .11 RPM
bodymap2_kidney 3 .43 RPM 286 .07 RPM
bodymap2_liver 0 .78 RPM 131 .24 RPM
bodymap2_lung 4 .10 RPM 400 .02 RPM
bodymap2_lymph_node 1 .21 RPM 214 .39 RPM
bodymap2_ovary 0 .79 RPM 204 .28 RPM
bodymap2_prostate 5 .01 RPM 254 .52 RPM
bodymap2_skeletal_muscle 0 .56 RPM 82 .70 RPM
bodymap2_testis 2 .66 RPM 220 .58 RPM
bodymap2_thyroid 18 .25 RPM 340 .26 RPM
bodymap2_white_blood_cells 0 .63 RPM 302 .19 RPM
RNA Polymerase II activity may be related with retro_hsap_12 in 8 libraries
ENCODE library ID Target ChIP-Seq Peak coordinates
ENCFF002CFW POLR2A 14:61747330..61747650
ENCFF002CFX POLR2A 14:61747319..61747623
ENCFF002CJE POLR2A 14:61747645..61748281
ENCFF002CJE POLR2A 14:61747846..61748482
ENCFF002DAE POLR2A 14:61747335..61747645
ENCFF002DBB POLR2A 14:61747391..61747591
ENCFF002DBO POLR2A 14:61747103..61747652
ENCFF002DBO POLR2A 14:61747714..61748453
ENCFF002DBP POLR2A 14:61747900..61748174
ENCFF002DBP POLR2A 14:61748218..61748457
ENCFF002DBQ POLR2A 14:61748261..61748457
ENCFF002DBQ POLR2A 14:61747901..61748271
1 EST(s) were mapped to retro_hsap_12 retrocopy
EST ID Start End Identity Match Mis-match Score
DB209474 61746771 61747310 99.7 537 2 535


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr ≤ 1 1 < Expr ≤ 5 5 < Expr ≤ 10 Expr > 10
TSS #1 TSS_392451449 libraries 234 libraries 125 libraries 21 libraries 0 libraries
TSS #2 TSS_392461585 libraries 219 libraries 25 libraries 0 libraries 0 libraries
TSS #3 TSS_392471419 libraries 284 libraries 126 libraries 0 libraries 0 libraries
TSS #4 TSS_392481328 libraries 168 libraries 96 libraries 66 libraries 171 libraries
TSS #5 TSS_392491481 libraries 147 libraries 178 libraries 20 libraries 3 libraries
TSS #6 TSS_392501564 libraries 175 libraries 87 libraries 3 libraries 0 libraries
TSS #7 TSS_392511303 libraries 153 libraries 114 libraries 54 libraries 205 libraries
TSS #8 TSS_392521373 libraries 156 libraries 146 libraries 123 libraries 31 libraries
TSS #9 TSS_392531493 libraries 150 libraries 180 libraries 6 libraries 0 libraries
TSS #10 TSS_392541416 libraries 135 libraries 241 libraries 28 libraries 9 libraries
TSS #11 TSS_392551417 libraries 190 libraries 209 libraries 9 libraries 4 libraries
TSS #12 TSS_392561641 libraries 165 libraries 23 libraries 0 libraries 0 libraries

The graphical summary, for retro_hsap_12 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

retro_hsap_12 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_12 has 0 orthologous retrocopies within eutheria group .


Parental genes homology:
Parental genes homology involve 15 parental genes, and 15 retrocopies.

Species Parental gene accession Retrocopies number
Bos taurus ENSBTAG000000051001 retrocopy
Canis familiaris ENSCAFG000000027081 retrocopy
Callithrix jacchus ENSCJAG000000103251 retrocopy
Cavia porcellus ENSCPOG000000207121 retrocopy
Homo sapiens ENSG00000112697 1 retrocopy
retro_hsap_12 ,
Myotis lucifugus ENSMLUG000000119231 retrocopy
Monodelphis domestica ENSMODG000000185021 retrocopy
Mus musculus ENSMUSG000000323281 retrocopy
Nomascus leucogenys ENSNLEG000000049621 retrocopy
Otolemur garnettii ENSOGAG000000157181 retrocopy
Pongo abelii ENSPPYG000000167821 retrocopy
Pelodiscus sinensis ENSPSIG000000071741 retrocopy
Rattus norvegicus ENSRNOG000000108951 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000025431 retrocopy
Tarsius syrichta ENSTSYG000000082111 retrocopy

Expression level across human populations :

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2089

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2112

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2135

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2158

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2181

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2204

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2227

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2250

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2273

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2296

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2325

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2348

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2371

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2394

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2417

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2440

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2463

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2486

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2509

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2532

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2553

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2576

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2599

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2622

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2645

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2668

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2691

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2714

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2737

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2760

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2787

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2810

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2837

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2860

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2887

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2910

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2937

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2960

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2987

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3010

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3122

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3145

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3168

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3191

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3214

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3241

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3264

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3287

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3310

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3333

Notice: Undefined variable: populLEGEND in /home/retrogenedb/www/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM
Could not execute MySQL populData: