Parental gene:

TPM1, ENSMEUG00000014581

Aliases:None
Description:tropomyosin 1 (alpha) [Source:HGNC Symbol;Acc:12010]
Organism:Wallaby (Macropus eugenii)
Coordinates:GeneScaffold_5072:16023..42540(+)


>ENSMEUG00000014581
ATGGATGCCATCAAGAAGAAGATGCAGATGCTGAAGCTGGACAAGGAGAATGCCTTGGACCGGGCTGAGCAGGCGGAGGC
CGATAAGAAGGCAGCGGAGGACCGCAGCAAGCAGCTCGAGGAAGACATTTCGGCTAAAGAGAAGCTGCTGCGCGAGGCGG
AGGATGAGCGGGACCGGGTGCTGGAGGAGCTGCATAAGGCGGAGGACAGCCTCCTCACCGCAGATGAAACCGCCGCCAAG
CTGGAGGACGAGCTGGTCTCCCTGCAAAAGAAGCTGAAGGGCACCGAGGATGAACTGGACAAGTATTCTGAGGCCCTCAA
AGACGCCCAAGAGAAATTGGAGCTGGCGGAGAAAAAGGCGACAGATGCTGAAGCTGATGTAGCTTCTTTGAACAGACGTA
TCCAGCTGGTTGAGGAAGAGTTGGACAGAGCTCAAGAGCGTCTGGCAACTGCCCTGCAGAAATTGGAGGAGGCTGAAAAG
GCAGCAGATGAGAGTGAGAGAGGAATGAAGGTCATTGAAAGCAGAGCCCAAAAGGATGAGGAGAAAATGGAAATTCAGGA
GATTCAACTTAAAGAGGCTAAGCACATTGCTGAGGATGCCGACCGAAAGTATGAAGAGGTGGCCCGGAAACTGGTCATCA
TTGAAAGCGACCTGGAGCGTGCAGAAGAGCGTGCTGAGCTCTCAGAAGGCAAATGTGCCGAGCTTGAAGAAGAGTTGAAA
ACTGTGACGAACAACCTGAAGTCACTGGAGGCTCAGGCTGAGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAGAAAGTGGCACATGCCAAGGAAGAAAATCTTAGTATGCATCAGATGTTGGATCAGACTTTA
CTGGAGTTAAACAACATGTGA

Species Parental gene accession Homology type Retrogenes number
Canis familiaris ENSCAFG00000016966 ortholog_one2one 1 retrogene
Choloepus hoffmanni ENSCHOG00000012788 ortholog_one2one 11 retrogenes
Callithrix jacchus ENSCJAG00000004355 ortholog_one2one 2 retrogenes
Pongo abelii ENSPPYG00000006534 ortholog_one2one 1 retrogene
Rattus norvegicus ENSRNOG00000018184 ortholog_one2one 1 retrogene
Ictidomys tridecemlineatus ENSSTOG00000009955 ortholog_one2many 1 retrogene
Tursiops truncatus ENSTTRG00000003762 ortholog_one2one 1 retrogene
Vicugna pacos ENSVPAG00000003277 ortholog_one2one 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_meug_1944 58.93 51.53
Please wait, loading
Please wait, loading
Please wait, loading
2. retro_meug_2161 61.27 53.07
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ENSMEUG00000014581 retrocopies