RetrogeneDB ID:

retro_chof_346

Retrocopy
location
Organism:Sloth (Choloepus hoffmanni)
Coordinates:GeneScaffold_7967:48331..48943(-)
Located in intron of:ENSCHOG00000004507
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:TPM1
Ensembl ID:ENSCHOG00000012788
Aliases:None
Description:tropomyosin 1 (alpha) [Source:HGNC Symbol;Acc:12010]


Retrocopy-Parental alignment summary:






>retro_chof_346
GCTGAGGCAGATGTGGCCTCCCTGAACTGCCACATTCAGCTGGTAGAGGAGGAGCTGGACCAGGCACAGGAGCGCCGGGC
CACAGCCCTGCAAAAGCTGGAGGAGGCTGAGAAGGCAGCTGATGAGAGTGAAAGAGGAACGAAGGTCATTGAGAACTGGG
CCATGAAGGACGAGGAAAAGATGGAGCTGCAGGAGATGCAACTGAAGGAGGCCAAGCACATAGCTGAGGACTCAGACCGC
AAATATGAGGAGGTGGCCAGGAAGATGGTGATCCTGGAAGGTGAGCTGGAGCGCTCAGAAGAGAGAGCTGAGGTGGCTGA
AAGTAAATGCGGGGACCTAGAGGAGGAGCTGAAAATTGTTACCAACAACTTGAAATCTCTGGAGGCCCAAGCAGACAAGT
ATTCCACCAAAGAGGATAAATATGAAGAGGAGATCAAACTGCTGGAGGAGAAGCTGAAGGAGGCTGAGACCCGAGCAGAA
TTTGCTGAAAGGTCTGTGGCAAAGTTGGAGAAAACCATCGATGACCTGGAAGAGACCTTGGCCAGTGCCAAGGAGGAGAA
CATGGAGATTCACCAGACCCTGGACCAGACCCTGCTGGAACTCAACAACCTG

ORF - retro_chof_346 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 81.37 %
Parental protein coverage: 100. %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalAEADVASLNRRIQLVEEELDRAQERLATALQKLEEAEKAADESERGMKVIESRAQKDEEKMEIQEIQLKE
AEADVASLN..IQLVEEELD.AQER.ATALQKLEEAEKAADESERG.KVIE..A.KDEEKME.QE.QLKE
RetrocopyAEADVASLNCHIQLVEEELDQAQERRATALQKLEEAEKAADESERGTKVIENWAMKDEEKMELQEMQLKE
ParentalAKHIAEDADRKYEEVARKLII-ESDLERAEERAELSEGKCAELEEELKTVTNNLKSLEAQAEKYSQKEDK
AKHIAED.DRKYEEVARK..I.E..LER.EERAE..E.KC..LEEELK.VTNNLKSLEAQA.KYS.KEDK
RetrocopyAKHIAEDSDRKYEEVARKMVILEGELERSEERAEVAESKCGDLEEELKIVTNNLKSLEAQADKYSTKEDK
ParentalYEEEIKVLSDKLKEAETRAEFAERSVTKLEKSIDDLEEKVAHAKEENLSMHQMLDQTLLELNNM
YEEEIK.L..KLKEAETRAEFAERSV.KLEK.IDDLEE..A.AKEEN...HQ.LDQTLLELNN.
RetrocopyYEEEIKLLEEKLKEAETRAEFAERSVAKLEKTIDDLEETLASAKEENMEIHQTLDQTLLELNNL

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Choloepus hoffmanni was not studied using RNA-Seq expression data.
Choloepus hoffmanni was not studied using ChIP-Seq data.
Choloepus hoffmanni was not studied using EST data.
Choloepus hoffmanni was not studied using FANTOM5 data.
retro_chof_346 was not experimentally validated.

Retrocopy orthology:
Choloepus hoffmanni does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 9 parental genes, and 21 retrocopies.

Species Parental gene accession Retrocopies number
Canis familiaris ENSCAFG000000169661 retrocopy
Choloepus hoffmanni ENSCHOG00000012788 11 retrocopies
Callithrix jacchus ENSCJAG000000043552 retrocopies
Macropus eugenii ENSMEUG000000145812 retrocopies
Pongo abelii ENSPPYG000000065341 retrocopy
Rattus norvegicus ENSRNOG000000181841 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000099551 retrocopy
Tursiops truncatus ENSTTRG000000037621 retrocopy
Vicugna pacos ENSVPAG000000032771 retrocopy



Copyright © RetrogeneDB 2014-2017