Parental gene:

TPM1, ENSCHOG00000012788

Aliases:None
Description:tropomyosin 1 (alpha) [Source:HGNC Symbol;Acc:12010]
Organism:Sloth (Choloepus hoffmanni)
Coordinates:GeneScaffold_4024:10386..24179(+)


>ENSCHOG00000012788
GCTGAAGCCGATGTAGCTTCTCTGAACAGACGTATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGGCTGGC
AACAGCTCTGCAGAAGCTGGAAGAGGCTGAGAAGGCAGCAGATGAGAGCGAGAGAGGCATGAAAGTCATTGAAAGTCGAG
CCCAAAAGGATGAGGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATCGCTGAAGATGCTGACCGC
AAGTATGAAGAGGTGGCCCGTAAGCTGATCATTGAGAGTGACCTGGAACGTGCAGAGGAGCGGGCCGAGCTCTCAGAAGG
CAAATGTGCCGAACTTGAAGAAGAATTGAAAACTGTGACGAACAACTTGAAGTCACTGGAGGCTCAGGCTGAGAAGTACT
CGCAGAAGGAAGACAAGTATGAGGAAGAGATCAAGGTCCTTTCTGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTT
GCAGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCT
TAGTATGCATCAGATGCTGGATCAGACTTTACTGGAGTTAAACAACATGTGA

Species Parental gene accession Homology type Retrogenes number
Canis familiaris ENSCAFG00000016966 ortholog_one2one 1 retrogene
Callithrix jacchus ENSCJAG00000004355 ortholog_one2one 2 retrogenes
Macropus eugenii ENSMEUG00000014581 ortholog_one2one 2 retrogenes
Pongo abelii ENSPPYG00000006534 ortholog_one2one 1 retrogene
Rattus norvegicus ENSRNOG00000018184 ortholog_one2one 1 retrogene
Ictidomys tridecemlineatus ENSSTOG00000009955 ortholog_one2many 1 retrogene
Tursiops truncatus ENSTTRG00000003762 ortholog_one2one 1 retrogene
Vicugna pacos ENSVPAG00000003277 ortholog_one2one 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_chof_346 81.37 100.00
Please wait, loading
Please wait, loading
Please wait, loading
2. retro_chof_399 82.24 52.71
Please wait, loading
Please wait, loading
Please wait, loading
3. retro_chof_412 68.72 87.19
Please wait, loading
Please wait, loading
Please wait, loading
4. retro_chof_770 76.17 94.58
Please wait, loading
Please wait, loading
Please wait, loading
5. retro_chof_967 75.61 60.10
Please wait, loading
Please wait, loading
Please wait, loading
6. retro_chof_1194 76.67 58.13
Please wait, loading
Please wait, loading
Please wait, loading
7. retro_chof_1272 59.72 69.95
Please wait, loading
Please wait, loading
Please wait, loading
8. retro_chof_1360 67.02 91.63
Please wait, loading
Please wait, loading
Please wait, loading
9. retro_chof_1789 78.29 74.38
Please wait, loading
Please wait, loading
Please wait, loading
10. retro_chof_1829 81.68 99.01
Please wait, loading
Please wait, loading
Please wait, loading
11. retro_chof_2309 67.80 99.51
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ENSCHOG00000012788 retrocopies