Parental gene: | FABP3, ENSMEUG00000012501 |
| Aliases: | None |
| Description: | fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) [Source:HGNC Symbol;Acc:3557] |
| Organism: | Wallaby (Macropus eugenii) |
| Coordinates: | GeneScaffold_3452:4006..13779(-) |
>ENSMEUG00000012501
ATGGCAGATGCTTTCGTCGGCACCTGGAAGCTGATTGACAGCAAGAACTTCGATGACTACATGAAATCCATCGGGGTTGG
CTTTGCCACAAGGCAGGTGGGCAACATGACCAAGCCCACCACCATCATCCAGATCAGTGGGGACACCATCACTCTCAAGA
CTCAGAGCACTTTCAAGAACACTGAGATCTCCTTCAAGCTAGGAGTAGAATTTGATGAGACAACAGCTGATGACAGGAAG
GTCAAGTCTCTCGTCACACTGGATGGAGGTAAACTTGTCCACGTCCAGAAGTGGGACGGACAGGAGACCACACTCGTTCG
GGAGCTCCAGGATGGCAAGCTCATTCTGACACTAACCCATGGCAGTGCAGTCTGCGTTAGGACCTACGAGAAGGAGGCAT
GG
| Species | Parental gene accession | Homology type | Retrogenes number | |
|---|---|---|---|---|
| Bos taurus | ENSBTAG00000016819 | ortholog_one2one | 2 retrogenes | |
| Danio rerio | ENSDARG00000023290 | ortholog_one2one | 1 retrogene | |
| Dasypus novemcinctus | ENSDNOG00000000511 | ortholog_one2one | 2 retrogenes | |
| Equus caballus | ENSECAG00000024852 | ortholog_one2one | 1 retrogene | |
| Homo sapiens | ENSG00000121769 | ortholog_one2one | 1 retrogene | |
| Gorilla gorilla | ENSGGOG00000014432 | ortholog_one2one | 1 retrogene | |
| Macropus eugenii | ENSMEUG00000002136 | within_species_paralog | 1 retrogene | |
| Macropus eugenii | ENSMEUG00000003195 | other_paralog | 2 retrogenes | |
| Microcebus murinus | ENSMICG00000009359 | ortholog_one2one | 4 retrogenes | |
| Myotis lucifugus | ENSMLUG00000013609 | ortholog_one2many | 2 retrogenes | |
| Mus musculus | ENSMUSG00000028773 | ortholog_one2many | 3 retrogenes | |
| Nomascus leucogenys | ENSNLEG00000001586 | ortholog_one2one | 1 retrogene | |
| Otolemur garnettii | ENSOGAG00000013757 | ortholog_one2one | 4 retrogenes | |
| Pongo abelii | ENSPPYG00000001616 | ortholog_one2one | 1 retrogene | |
| Pan troglodytes | ENSPTRG00000000457 | ortholog_one2one | 1 retrogene | |
| Rattus norvegicus | ENSRNOG00000012879 | ortholog_one2one | 1 retrogene | |
| Ictidomys tridecemlineatus | ENSSTOG00000003842 | ortholog_one2one | 3 retrogenes |
| # | RetrogeneDB ID | Identity (%) | Coverage (%) | ORF conservation | Expression evidence | RDV |
|---|---|---|---|---|---|---|
| 1. | retro_meug_148 | 86.26 | 97.76 | Please wait, loading  |
Please wait, loading |
Please wait, loading |
| 2. | retro_meug_273 | 78.64 | 76.12 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 3. | retro_meug_563 | 68.70 | 97.76 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 4. | retro_meug_819 | 83.46 | 98.51 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 5. | retro_meug_1037 | 85.07 | 99.25 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 6. | retro_meug_1660 | 95.52 | 99.25 | Please wait, loading |
Please wait, loading |
Please wait, loading |
Download FASTA sequences of all ENSMEUG00000012501 retrocopies