RetrogeneDB ID:

retro_btau_1531

Retrocopy
location
Organism:Cow (Bos taurus)
Coordinates:7:40193692..40193889(+)
Located in intron of:ENSBTAG00000008034
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:RPL37A
Ensembl ID:ENSBTAG00000003846
Aliases:None
Description:60S ribosomal protein L37a [Source:UniProtKB/Swiss-Prot;Acc:Q3MIC0]


Retrocopy-Parental alignment summary:






>retro_btau_1531
TCCTTCAGGAAAATGGTGAAGAGAATGGAAATCAGCCAGCACAACAAGCACACTTGCTCCTGTGACAAAACCAAGATGAA
GAGGCAAGCTGCGGGGATCTGCTGCTGTGGTTCTTTCGAGAGAACAGTAGCTGGTGGTGCCTGAACCAACGCCACCACTT
CTGCCATCACAGGAAGTCAGGCCTCTGAAGACTGAAG

ORF - retro_btau_1531 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 66.18 %
Parental protein coverage: 72.83 %
Number of stop codons detected: 2
Number of frameshifts detected 1


Retrocopy - Parental Gene Alignment:

ParentalSLRKMVKKIEISQHAKYTCSFCGKTKMKRRAVGIWHCGSCMKTVAGGAWTYNTTSAVT-VKSAIRRLK
S.RKMVK..EISQH.K.TCS.C.KTKMKR.A.GI..CGS...TVAGGA.T..TTSA.T..KS...RLK
RetrocopySFRKMVKRMEISQHNKHTCS-CDKTKMKRQAAGICCCGSFERTVAGGA*TNATTSAIT<RKSGL*RLK

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
ERP005899_liver 0 .07 RPM 245 .27 RPM
ERP005899_muscle 0 .05 RPM 776 .84 RPM
SRP017611_brain 0 .05 RPM 70 .89 RPM
SRP017611_kidney 0 .06 RPM 207 .75 RPM
SRP017611_liver 0 .08 RPM 128 .97 RPM
SRP030211_testis 0 .02 RPM 95 .87 RPM
Bos taurus was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_btau_1531 retrocopy.
Bos taurus was not studied using FANTOM5 data.
retro_btau_1531 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_btau_1531 has 0 orthologous retrocopies within eutheria group .


Parental genes homology:
Parental genes homology involve 17 parental genes, and 243 retrocopies.

Species Parental gene accession Retrocopies number
Bos taurus ENSBTAG00000003846 9 retrocopies
Choloepus hoffmanni ENSCHOG0000000400014 retrocopies
Felis catus ENSFCAG0000002701021 retrocopies
Homo sapiens ENSG000001977566 retrocopies
Gorilla gorilla ENSGGOG000000148275 retrocopies
Latimeria chalumnae ENSLACG000000115781 retrocopy
Monodelphis domestica ENSMODG000000254859 retrocopies
Mus musculus ENSMUSG0000004633018 retrocopies
Nomascus leucogenys ENSNLEG000000072768 retrocopies
Ochotona princeps ENSOPRG0000000443610 retrocopies
Petromyzon marinus ENSPMAG000000000011 retrocopy
Pongo abelii ENSPPYG000000258781 retrocopy
Pan troglodytes ENSPTRG000000290296 retrocopies
Sarcophilus harrisii ENSSHAG0000001341710 retrocopies
Tupaia belangeri ENSTBEG00000007409108 retrocopies
retro_tbel_1089, retro_tbel_1095, retro_tbel_1113, retro_tbel_1168, retro_tbel_1198, retro_tbel_1204, retro_tbel_1218, retro_tbel_1244, retro_tbel_1345, retro_tbel_1352, retro_tbel_141, retro_tbel_1434, retro_tbel_1466, retro_tbel_1471, retro_tbel_148, retro_tbel_1489, retro_tbel_1502, retro_tbel_151, retro_tbel_1534, retro_tbel_1683, retro_tbel_1714, retro_tbel_1807, retro_tbel_1835, retro_tbel_1838, retro_tbel_1922, retro_tbel_194, retro_tbel_1973, retro_tbel_1992, retro_tbel_1995, retro_tbel_2002, retro_tbel_2044, retro_tbel_2083, retro_tbel_209, retro_tbel_2101, retro_tbel_2178, retro_tbel_2190, retro_tbel_223, retro_tbel_2381, retro_tbel_2631, retro_tbel_2699, retro_tbel_2705, retro_tbel_2725, retro_tbel_2780, retro_tbel_2813, retro_tbel_2844, retro_tbel_285, retro_tbel_286, retro_tbel_2985, retro_tbel_3022, retro_tbel_3048, retro_tbel_3108, retro_tbel_3118, retro_tbel_3211, retro_tbel_3490, retro_tbel_350, retro_tbel_3565, retro_tbel_3593, retro_tbel_3632, retro_tbel_3641, retro_tbel_3651, retro_tbel_3757, retro_tbel_3784, retro_tbel_3837, retro_tbel_3901, retro_tbel_3910, retro_tbel_3912, retro_tbel_3916, retro_tbel_3919, retro_tbel_3955, retro_tbel_3969, retro_tbel_3970, retro_tbel_4055, retro_tbel_4098, retro_tbel_4099, retro_tbel_4117, retro_tbel_412, retro_tbel_4148, retro_tbel_4188, retro_tbel_420, retro_tbel_4244, retro_tbel_4382, retro_tbel_4452, retro_tbel_4522, retro_tbel_4524, retro_tbel_458, retro_tbel_4586, retro_tbel_4588, retro_tbel_4613, retro_tbel_4703, retro_tbel_472, retro_tbel_500, retro_tbel_566, retro_tbel_574, retro_tbel_583, retro_tbel_590, retro_tbel_594, retro_tbel_595, retro_tbel_622, retro_tbel_648, retro_tbel_681, retro_tbel_739, retro_tbel_767, retro_tbel_790, retro_tbel_834, retro_tbel_870, retro_tbel_893, retro_tbel_907, retro_tbel_998,
Tarsius syrichta ENSTSYG0000000425811 retrocopies
Vicugna pacos ENSVPAG000000025295 retrocopies





Copyright © RetrogeneDB 2014-2017