Parental gene:

LAMTOR3, ENSCHOG00000013153

Aliases:None
Description:late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 [Source:HGNC Symbol;Acc:15606]
Organism:Sloth (Choloepus hoffmanni)
Coordinates:GeneScaffold_1852:751..7934(-)


>ENSCHOG00000013153
GACCTAAAACGGTTCCTGTATAAAAAATTACCAAGTGTTGAAGGGCTCCATGCTATTGTTGTGTCAGATAGAGATGGTGT
ACCTGTTATTAAAGTGGCCAATGATAATGCTCCAGAGCATGCTTTAAGACCTGGTTTCTTATCTACTTTTGCCCTTGCAA
CAGACCAAGGGAGCAAACTTGGACTTTCAAAAAACAAAAGTATTATCTGTTACTATAACACCTACCAGGTGGTTCAATTT
AATCGTTTACCTTTGGTGGTGAGTTTCATAGCCAGCAGCAGTGCCAACACAGGACTAATTGTCAGTCTAGAAAAGGAACT
TGCTCCATTATTTGAAGAACTGAGACAAGTTGTGGAAGTTTCTTAT

Species Parental gene accession Homology type Retrogenes number
Ailuropoda melanoleuca ENSAMEG00000000995 ortholog_one2one 4 retrogenes
retro_amel_1266, retro_amel_1278, retro_amel_1833, retro_amel_610,
Bos taurus ENSBTAG00000007923 ortholog_one2one 1 retrogene
retro_btau_578,
Canis familiaris ENSCAFG00000029975 ortholog_one2one 3 retrogenes
retro_cfam_1425, retro_cfam_692, retro_cfam_700,
Callithrix jacchus ENSCJAG00000015196 ortholog_one2one 4 retrogenes
retro_cjac_1149, retro_cjac_1821, retro_cjac_2581, retro_cjac_2786,
Cavia porcellus ENSCPOG00000013304 ortholog_one2many 2 retrogenes
retro_cpor_112, retro_cpor_208,
Dasypus novemcinctus ENSDNOG00000025421 ortholog_one2one 14 retrogenes
retro_dnov_1057, retro_dnov_118, retro_dnov_1190, retro_dnov_1332, retro_dnov_137, retro_dnov_2003, retro_dnov_2213, retro_dnov_2597, retro_dnov_2665, retro_dnov_487, retro_dnov_522, retro_dnov_626, retro_dnov_938, retro_dnov_939,
Dipodomys ordii ENSDORG00000015501 ortholog_one2one 5 retrogenes
retro_dord_328, retro_dord_379, retro_dord_546, retro_dord_756, retro_dord_771,
Equus caballus ENSECAG00000013569 ortholog_one2one 1 retrogene
retro_ecab_138,
Echinops telfairi ENSETEG00000009065 ortholog_one2one 6 retrogenes
retro_etel_1271, retro_etel_1421, retro_etel_1621, retro_etel_1639, retro_etel_471, retro_etel_794,
Homo sapiens ENSG00000109270 ortholog_one2one 2 retrogenes
retro_hsap_1190, retro_hsap_3374,
Gorilla gorilla ENSGGOG00000001132 ortholog_one2one 2 retrogenes
retro_ggor_2283, retro_ggor_928,
Loxodonta africana ENSLAFG00000015740 ortholog_one2one 1 retrogene
retro_lafr_480,
Myotis lucifugus ENSMLUG00000006786 ortholog_one2one 2 retrogenes
retro_mluc_2415, retro_mluc_445,
Macaca mulatta ENSMMUG00000006830 ortholog_one2one 1 retrogene
retro_mmul_2104,
Monodelphis domestica ENSMODG00000020688 ortholog_one2one 3 retrogenes
retro_mdom_1133, retro_mdom_455, retro_mdom_907,
Mustela putorius furo ENSMPUG00000009569 ortholog_one2one 2 retrogenes
retro_mputfur_590, retro_mputfur_877,
Mus musculus ENSMUSG00000091512 ortholog_one2many 1 retrogene
retro_mmus_167,
Nomascus leucogenys ENSNLEG00000013684 ortholog_one2one 2 retrogenes
retro_nleu_1936, retro_nleu_965,
Otolemur garnettii ENSOGAG00000005336 ortholog_one2one 4 retrogenes
retro_ogar_2081, retro_ogar_2120, retro_ogar_3435, retro_ogar_451,
Pongo abelii ENSPPYG00000014955 ortholog_one2one 3 retrogenes
retro_pabe_1268, retro_pabe_2772, retro_pabe_991,
Pan troglodytes ENSPTRG00000016310 ortholog_one2one 1 retrogene
retro_ptro_2294,
Pteropus vampyrus ENSPVAG00000017674 ortholog_one2one 1 retrogene
retro_pvam_1378,
Rattus norvegicus ENSRNOG00000010552 ortholog_one2one 1 retrogene
retro_rnor_2341,
Sus scrofa ENSSSCG00000009176 ortholog_one2one 1 retrogene
retro_sscr_148,
Tupaia belangeri ENSTBEG00000003682 ortholog_one2one 6 retrogenes
retro_tbel_1932, retro_tbel_2172, retro_tbel_230, retro_tbel_3358, retro_tbel_4521, retro_tbel_924,
Tursiops truncatus ENSTTRG00000015015 ortholog_one2one 1 retrogene
retro_ttru_809,

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_chof_166 92.62 99.18
Please wait, loading
Please wait, loading
Please wait, loading
2. retro_chof_955 66.00 77.87
Please wait, loading
Please wait, loading
Please wait, loading
3. retro_chof_1167 84.21 92.62
Please wait, loading
Please wait, loading
Please wait, loading
4. retro_chof_1236 66.13 99.18
Please wait, loading
Please wait, loading
Please wait, loading
5. retro_chof_1266 86.75 67.21
Please wait, loading
Please wait, loading
Please wait, loading
6. retro_chof_1536 74.49 79.51
Please wait, loading
Please wait, loading
Please wait, loading
7. retro_chof_1929 85.00 65.57
Please wait, loading
Please wait, loading
Please wait, loading
Download FASTA sequences of all ENSCHOG00000013153 retrocopies