RetrogeneDB ID:

retro_hsap_3784

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:7:128696024..128696821(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000230359
Aliases:None
Status:KNOWN_PSEUDOGENE
Parental gene
information
Parental gene summary:
Parental gene symbol:TPI1
Ensembl ID:ENSG00000111669
Aliases:TPI1, HEL-S-49, TIM, TPI, TPID
Description:triosephosphate isomerase 1 [Source:HGNC Symbol;Acc:12009]


Retrocopy-Parental alignment summary:






>retro_hsap_3784
CCCGTTTTAGGCGCTGACACTGACCTACAGCGCCTCAGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCGTGGGGAG
GAACTGGAAGATGAACGGGCGGAAGAAATGTCTGGGGGAGCTCATCGGCACTCAGAACGCGGCCACTGTGCCTGCCGACA
CCAAGGTGATTTGTGCTCTCGCCACTGCGTATAACGAGTTGGCCCGGCAGAAGCTAGCTCCCAAGATTGCTGTGGCTCCG
CAGAACTGCTACAAAGTGACTAATGGGGCCTTTACTGGGGAGATCAGCCCTGGCATGGTCAAAGACTTAGGAGTCACGTG
GGTGGTGTGGTCCTGGGGCACTCAGAAGGCGTGTCTTTGGGGAGTCAGATGAGCTGATTGGGCAGAAAAGTGGCCCATGC
TCTGGCAGAGAGACTCGGAGTAATCGCCTGCATTGGGGAGAAGCTAGATGAAAGGGAAGCTGGCATCACTGAGAAGGTTG
TTTTTGAGCAGACAAAGGTCATCGCAGATAATGTGAAGGACTGGAGCAAGGTCATCTTGGCCTATGATCCCGTGTGGGCC
ACTGGTACTGGCAAGACTGCAACACCCCAACAGGCCCAGGAGGTACACAAGAAGCTCCGAGGATGGCTTAAGTCCAACAT
CTCTGATGCAGTGGCTCAGAGCACTGGTATCATTTATGGAGGCTCTGTGACCAAGGCAACCTGCAAGGAGCTGGCCAGCC
AGCCTGACGTGGCTGCCTTCCTCATGAGTGGTGTTTCCCTCAAGCCCGAATTCGTAGACATCATCAATGCCAAACAA

ORF - retro_hsap_3784 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 84.64 %
Parental protein coverage: 92.66 %
Number of stop codons detected: 0
Number of frameshifts detected: 2


Retrocopy - Parental Gene Alignment:

ParentalPRLRADTDLQRLGSSAMAPSRKFFVGGNWKMNGRKQSLGELIGTLNAAKVPADTEVVCAPPTAYIDFARQ
P.L.ADTDLQRL.SSAMAPSRKFFVG.NWKMNGRK..LGELIGT.NAA.VPADT.V.CA..TAY...ARQ
RetrocopyPVLGADTDLQRLSSSAMAPSRKFFVGRNWKMNGRKKCLGELIGTQNAATVPADTKVICALATAYNELARQ
ParentalKLDPKIAVAAQNCYKVTNGAFTGEISPGMIKDCGATWVVLGHSE-RRHVFGESDELIGQK-VAHALAEGL
KL.PKIAVA.QNCYKVTNGAFTGEISPGM.KD.G.TWVV......RR.VFGESDELIGQK.VAHALAE.L
RetrocopyKLAPKIAVAPQNCYKVTNGAFTGEISPGMVKDLGVTWVVWSWGT>RRRVFGESDELIGQK>VAHALAERL
ParentalGVIACIGEKLDEREAGITEKVVFEQTKVIADNVKDWSKVVLAYEPVWAIGTGKTATPQQAQEVHEKLRGW
GVIACIGEKLDEREAGITEKVVFEQTKVIADNVKDWSKV.LAY.PVWA.GTGKTATPQQAQEVH.KLRGW
RetrocopyGVIACIGEKLDEREAGITEKVVFEQTKVIADNVKDWSKVILAYDPVWATGTGKTATPQQAQEVHKKLRGW
ParentalLKSNVSDAVAQSTRIIYGGSVTGATCKELASQPDVDGFLVGGASLKPEFVDIINAKQ
LKSN.SDAVAQST.IIYGGSVT.ATCKELASQPDV..FL..G.SLKPEFVDIINAKQ
RetrocopyLKSNISDAVAQSTGIIYGGSVTKATCKELASQPDVAAFLMSGVSLKPEFVDIINAKQ

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 0 .22 RPM 114 .99 RPM
bodymap2_adrenal 0 .27 RPM 166 .21 RPM
bodymap2_brain 0 .38 RPM 183 .44 RPM
bodymap2_breast 0 .35 RPM 100 .37 RPM
bodymap2_colon 0 .00 RPM 201 .02 RPM
bodymap2_heart 0 .13 RPM 249 .39 RPM
bodymap2_kidney 0 .14 RPM 311 .03 RPM
bodymap2_liver 0 .13 RPM 166 .65 RPM
bodymap2_lung 0 .00 RPM 186 .37 RPM
bodymap2_lymph_node 0 .00 RPM 226 .08 RPM
bodymap2_ovary 0 .21 RPM 124 .80 RPM
bodymap2_prostate 0 .07 RPM 229 .77 RPM
bodymap2_skeletal_muscle 0 .02 RPM 191 .45 RPM
bodymap2_testis 0 .58 RPM 137 .27 RPM
bodymap2_thyroid 0 .30 RPM 125 .62 RPM
bodymap2_white_blood_cells 0 .08 RPM 209 .50 RPM
RNA Polymerase II activity may be related with retro_hsap_3784 in 52 libraries
ENCODE library ID Target ChIP-Seq Peak coordinates
ENCFF001VKU POLR2A 7:128694725..128695504
ENCFF002CFW POLR2A 7:128694508..128695515
ENCFF002CFX POLR2A 7:128695025..128695493
ENCFF002CFX POLR2A 7:128694533..128695082
ENCFF002CGN POLR2A 7:128695159..128695486
ENCFF002CGN POLR2A 7:128694739..128695045
ENCFF002CHO POLR2A 7:128694317..128695563
ENCFF002CIH POLR2A 7:128694698..128695082
ENCFF002CIO POLR2A 7:128694633..128695109
ENCFF002CIO POLR2A 7:128695090..128695508
ENCFF002CJE POLR2A 7:128694465..128695556
ENCFF002CJZ POLR2A 7:128694352..128695541
ENCFF002CKX POLR2A 7:128694707..128695490
ENCFF002CLM POLR2A 7:128694655..128695195
ENCFF002CLM POLR2A 7:128695289..128695436
ENCFF002CMI POLR2A 7:128694372..128695582
ENCFF002COJ POLR2A 7:128694712..128695148
ENCFF002COJ POLR2A 7:128694912..128695348
ENCFF002CPG POLR2A 7:128695177..128695498
ENCFF002CPH POLR2A 7:128695146..128695536
ENCFF002CQA POLR2A 7:128694885..128695542
ENCFF002CQC POLR2A 7:128695131..128695491
ENCFF002CQC POLR2A 7:128694712..128695053
ENCFF002CQE POLR2A 7:128695022..128695490
ENCFF002CQE POLR2A 7:128694533..128695067
ENCFF002CQG POLR2A 7:128694703..128695048
ENCFF002CQG POLR2A 7:128695153..128695493
ENCFF002CQI POLR2A 7:128695046..128695480
ENCFF002CQI POLR2A 7:128694704..128695048
ENCFF002CQK POLR2A 7:128694466..128695532
ENCFF002CQM POLR2A 7:128695105..128695494
ENCFF002CQM POLR2A 7:128694708..128695060
ENCFF002CQO POLR2A 7:128694616..128695103
ENCFF002CQO POLR2A 7:128695023..128695520
ENCFF002CRK POLR2A 7:128694703..128695227
ENCFF002CRK POLR2A 7:128694954..128695478
ENCFF002CRO POLR2A 7:128695332..128695437
ENCFF002CSY POLR2A 7:128694456..128695584
ENCFF002CUP POLR2A 7:128695178..128695494
ENCFF002CUP POLR2A 7:128694765..128695081
ENCFF002CUQ POLR2A 7:128694708..128695071
ENCFF002CVJ POLR2A 7:128694684..128695092
ENCFF002CXM POLR2A 7:128695143..128695513
ENCFF002CXN POLR2A 7:128695210..128695525
ENCFF002CXO POLR2A 7:128695174..128695486
ENCFF002CXP POLR2A 7:128694676..128695533
ENCFF002CXQ POLR2A 7:128694432..128695082
ENCFF002CXQ POLR2A 7:128694633..128695283
ENCFF002CXR POLR2A 7:128695047..128695498
ENCFF002CXR POLR2A 7:128694652..128695077
ENCFF002CZC POLR2A 7:128694661..128695537
ENCFF002CZD POLR2A 7:128694695..128695120
ENCFF002CZD POLR2A 7:128695124..128695513
ENCFF002CZQ POLR2A 7:128695161..128695477
ENCFF002CZQ POLR2A 7:128694762..128695042
ENCFF002CZW POLR2A 7:128694588..128695700
ENCFF002CZY POLR2A 7:128694490..128695532
ENCFF002DAE POLR2A 7:128695295..128695442
ENCFF002DAE POLR2A 7:128694720..128695030
ENCFF002DAH POLR2A 7:128695252..128695401
ENCFF002DAK POLR2A 7:128694664..128695164
ENCFF002DAS POLR2A 7:128694683..128695159
ENCFF002DAV POLR2A 7:128695002..128695546
ENCFF002DAY POLR2A 7:128694512..128695148
ENCFF002DAY POLR2A 7:128694713..128695349
ENCFF002DAY POLR2A 7:128694914..128695550
ENCFF002DBB POLR2A 7:128695225..128695425
ENCFF002DBB POLR2A 7:128694831..128695031
ENCFF002DBE POLR2A 7:128694986..128695495
ENCFF002DBE POLR2A 7:128694699..128695079
ENCFF002DBO POLR2A 7:128695155..128695482
ENCFF002DBO POLR2A 7:128694679..128695041
ENCFF002DBP POLR2A 7:128695200..128695458
ENCFF002DBQ POLR2A 7:128695206..128695460
ENCFF002DBQ POLR2A 7:128694721..128695091
ENCFF002DBT POLR2A 7:128695261..128695394
No EST(s) were mapped for retro_hsap_3784 retrocopy.
No TSS is located nearby retro_hsap_3784 retrocopy 5' end.
retro_hsap_3784 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_3784 has 0 orthologous retrocopies within eutheria group .


Parental genes homology:
Parental genes homology involve 13 parental genes, and 32 retrocopies.

Species Parental gene accession Retrocopies number
Callithrix jacchus ENSCJAG000000073482 retrocopies
Homo sapiens ENSG00000111669 3 retrocopies
retro_hsap_3038, retro_hsap_3510, retro_hsap_3784 ,
Gorilla gorilla ENSGGOG000000026231 retrocopy
Macropus eugenii ENSMEUG000000069775 retrocopies
Myotis lucifugus ENSMLUG000000249894 retrocopies
Macaca mulatta ENSMMUG000000051942 retrocopies
Mustela putorius furoENSMPUG000000167741 retrocopy
Mus musculus ENSMUSG000000234564 retrocopies
Nomascus leucogenys ENSNLEG000000048212 retrocopies
Otolemur garnettii ENSOGAG000000312541 retrocopy
Pan troglodytes ENSPTRG000000045954 retrocopies
Rattus norvegicus ENSRNOG000000152901 retrocopy
Rattus norvegicus ENSRNOG000000506692 retrocopies

Expression level across human populations :

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2089

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2112

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2135

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2158

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2181

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2204

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2227

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2250

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2273

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2296

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2325

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2348

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2371

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2394

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2417

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2440

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2463

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2486

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2509

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2532

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2553

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2576

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2599

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2622

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2645

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2668

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2691

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2714

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2737

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2760

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2787

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2810

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2837

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2860

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2887

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2910

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2937

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2960

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2987

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3010

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3122

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3145

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3168

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3191

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3214

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3241

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3264

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3287

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3310

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3333

Notice: Undefined variable: populLEGEND in /home/retrogenedb/www/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM
Could not execute MySQL populData: