pgwin88

789betwin

ufabet

pgwin88

baht89

https://rr.lpsh.net/amp

ufabetwin

https://brss.pattani1.go.th/video/

https://sp.moe.go.th/web_sp_68/book/

https://dol-bangkok.com/video/

ufabetwin

okvip

okvip

https://aicode.cyp.ac.th/video/

max77

RetrogeneDB - Retrocopy retro_hsap_34 details

RetrogeneDB ID:

retro_hsap_34

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:5:137088837..137089755(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000177733
Aliases:HNRNPA0, HNRPA0
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:HNRNPA3
Ensembl ID:ENSG00000170144
Aliases:HNRNPA3, 2610510D13Rik, D10S102, FBRNP, HNRPA3
Description:heterogeneous nuclear ribonucleoprotein A3 [Source:HGNC Symbol;Acc:24941]


Retrocopy-Parental alignment summary:






>retro_hsap_34
ATGGAGAATTCTCAGTTGTGTAAGCTGTTCATCGGCGGCCTCAATGTGCAGACGAGTGAGTCGGGCCTGCGCGGCCACTT
TGAGGCCTTTGGGACTCTGACGGACTGCGTGGTGGTGGTGAATCCCCAGACCAAGCGCTCCCGTTGCTTTGGCTTCGTGA
CCTACTCCAATGTGGAGGAGGCGGACGCCGCCATGGCCGCCTCGCCCCATGCCGTGGACGGCAACACTGTGGAGCTGAAG
CGGGCGGTGTCCCGGGAGGATTCGGCGCGGCCCGGTGCCCACGCCAAGGTTAAGAAGCTCTTTGTCGGAGGCCTTAAAGG
AGACGTGGCTGAGGGCGACCTGATCGAGCACTTCTCGCAGTTTGGCACCGTGGAAAAGGCCGAGATTATTGCCGACAAGC
AGTCCGGCAAGAAGCGTGGATTCGGCTTCGTGTATTTCCAGAATCACGACGCGGCAGACAAGGCCGCGGTGGTCAAGTTC
CATCCGATTCAGGGCCATCGCGTGGAGGTGAAGAAAGCAGTCCCCAAGGAGGATATCTACTCCGGTGGGGGTGGAGGCGG
CTCCCGATCCTCCCGGGGCGGCCGAGGCGGCCGGGGGCGCGGCGGTGGTCGAGACCAGAACGGCCTTTCCAAGGGCGGCG
GCGGCGGTTACAACAGCTACGGTGGTTACGGCGGCGGCGGAGGCGGCGGCTACAATGCCTACGGAGGCGGCGGCGGCGGT
TCGTCCTACGGTGGGAGCGACTACGGTAACGGCTTCGGCGGCTTCGGCAGCTACAGCCAGCATCAGTCCTCCTATGGGCC
CATGAAGAGCGGCGGCGGCGGCGGCGGTGGAGGCAGTAGCTGGGGCGGTCGCAGTAATAGTGGACCTTACAGAGGCGGCT
ATGGCGGTGGGGGTGGCTATGGAGGCAGCTCCTTCTAA

ORF - retro_hsap_34 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 54.28 %
Parental protein coverage: 79.37 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalEPEQLRKLFIGGLSFETTDDSLREHFEKWGTLTDCVVMRDPQTKRSRGFGFVTYSCVEEVDAAMCARPHK
E..QL.KLFIGGL...T....LR.HFE..GTLTDCVV...PQTKRSR.FGFVTYS.VEE.DAAM.A.PH.
RetrocopyENSQLCKLFIGGLNVQTSESGLRGHFEAFGTLTDCVVVVNPQTKRSRCFGFVTYSNVEEADAAMAASPHA
ParentalVDGRVVEPKRAVSREDSVKPGAHLTVKKIFVGGIKEDTEEYNLRDYFEKYGKIETIEVMEDRQSGKKRGF
VDG..VE.KRAVSREDS..PGAH..VKK.FVGG.K.D..E..L...F...G..E..E...D.QSGKKRGF
RetrocopyVDGNTVELKRAVSREDSARPGAHAKVKKLFVGGLKGDVAEGDLIEHFSQFGTVEKAEIIADKQSGKKRGF
ParentalAFVTFDDHDTVDKIVVQKYHTINGHNCEVKKALSKQEMQSA----GSQRGRGGGSGNFMGRGGNFGGGGG
.FV.F..HD..DK..V.K.H.I.GH..EVKKA..K....S.....GS...RGG..G...GRGG.....G.
RetrocopyGFVYFQNHDAADKAAVVKFHPIQGHRVEVKKAVPKEDIYSGGGGGGSRSSRGGRGGR--GRGGGRDQNGL
ParentalNFGRGGNFGGRGGYGGGGGGSRGSYGGGDGGYNGFGGDGGNYGGGPGYSSRGGYGGGGPGYGNQGGGYGG
..G.GG.....GGYGGGGGG....YGGG.GG....G.D.GN..GG.G..S......G....G..GGG.GG
RetrocopySKGGGGGYNSYGGYGGGGGGGYNAYGGGGGGSSYGGSDYGNGFGGFGSYSQHQSSYGPMKSG--GGGGGG
ParentalGGGYDGYNEGGNFGGGNYGGGGNY
G....G....G...GG.YGGGG.Y
RetrocopyGSSWGGRSNSGPYRGG-YGGGGGY

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 55 .56 RPM 347 .23 RPM
bodymap2_adrenal 59 .46 RPM 535 .07 RPM
bodymap2_brain 19 .55 RPM 339 .37 RPM
bodymap2_breast 28 .64 RPM 267 .51 RPM
bodymap2_colon 30 .28 RPM 432 .85 RPM
bodymap2_heart 10 .65 RPM 101 .85 RPM
bodymap2_kidney 20 .64 RPM 331 .49 RPM
bodymap2_liver 9 .00 RPM 119 .24 RPM
bodymap2_lung 40 .84 RPM 430 .05 RPM
bodymap2_lymph_node 32 .98 RPM 274 .00 RPM
bodymap2_ovary 60 .55 RPM 698 .84 RPM
bodymap2_prostate 24 .54 RPM 327 .14 RPM
bodymap2_skeletal_muscle 12 .39 RPM 119 .93 RPM
bodymap2_testis 29 .30 RPM 412 .92 RPM
bodymap2_thyroid 57 .70 RPM 465 .04 RPM
bodymap2_white_blood_cells 35 .24 RPM 279 .96 RPM
RNA Polymerase II activity may be related with retro_hsap_34 in 52 libraries
ENCODE library ID Target ChIP-Seq Peak coordinates
ENCFF001VKU POLR2A 5:137089845..137090446
ENCFF002CFW POLR2A 5:137089772..137090758
ENCFF002CFW POLR2A 5:137089089..137089519
ENCFF002CFX POLR2A 5:137089776..137090745
ENCFF002CFX POLR2A 5:137089137..137089533
ENCFF002CGN POLR2A 5:137089837..137090195
ENCFF002CGN POLR2A 5:137090137..137090374
ENCFF002CHO POLR2A 5:137088772..137091057
ENCFF002CIH POLR2A 5:137089841..137090178
ENCFF002CIH POLR2A 5:137090215..137090363
ENCFF002CIO POLR2A 5:137089800..137090437
ENCFF002CIO POLR2A 5:137088987..137089531
ENCFF002CJE POLR2A 5:137089623..137091123
ENCFF002CJZ POLR2A 5:137089755..137090743
ENCFF002CKX POLR2A 5:137089820..137090409
ENCFF002CLM POLR2A 5:137089775..137090315
ENCFF002CLM POLR2A 5:137089974..137090514
ENCFF002CMI POLR2A 5:137089464..137090840
ENCFF002COJ POLR2A 5:137090032..137090468
ENCFF002COJ POLR2A 5:137089803..137090239
ENCFF002COJ POLR2A 5:137090357..137090793
ENCFF002CPG POLR2A 5:137089854..137090194
ENCFF002CPG POLR2A 5:137089978..137090468
ENCFF002CPH POLR2A 5:137089986..137090143
ENCFF002CPH POLR2A 5:137090051..137090441
ENCFF002CQA POLR2A 5:137089925..137090495
ENCFF002CQA POLR2A 5:137090125..137090695
ENCFF002CQC POLR2A 5:137089840..137090402
ENCFF002CQC POLR2A 5:137090413..137090739
ENCFF002CQE POLR2A 5:137089823..137090412
ENCFF002CQE POLR2A 5:137090360..137090740
ENCFF002CQG POLR2A 5:137089856..137090416
ENCFF002CQG POLR2A 5:137090411..137090640
ENCFF002CQI POLR2A 5:137089848..137090198
ENCFF002CQI POLR2A 5:137090091..137090387
ENCFF002CQI POLR2A 5:137090389..137090711
ENCFF002CQK POLR2A 5:137089820..137090419
ENCFF002CQK POLR2A 5:137090365..137090761
ENCFF002CQM POLR2A 5:137089847..137090310
ENCFF002CQM POLR2A 5:137089847..137090346
ENCFF002CQM POLR2A 5:137090401..137090711
ENCFF002CQO POLR2A 5:137089812..137090451
ENCFF002CQO POLR2A 5:137090331..137090743
ENCFF002CRK POLR2A 5:137089972..137090496
ENCFF002CRK POLR2A 5:137090177..137090701
ENCFF002CRO POLR2A 5:137090340..137090760
ENCFF002CRO POLR2A 5:137090099..137090519
ENCFF002CRO POLR2A 5:137089987..137090096
ENCFF002CSY POLR2A 5:137089416..137090943
ENCFF002CUP POLR2A 5:137089898..137090160
ENCFF002CUP POLR2A 5:137090138..137090349
ENCFF002CUQ POLR2A 5:137089830..137090324
ENCFF002CUQ POLR2A 5:137089830..137090346
ENCFF002CVF POLR2A 5:137089908..137090118
ENCFF002CVF POLR2A 5:137090019..137090435
ENCFF002CVJ POLR2A 5:137089732..137090408
ENCFF002CXM POLR2A 5:137089873..137090149
ENCFF002CXM POLR2A 5:137089975..137090465
ENCFF002CXN POLR2A 5:137089960..137090087
ENCFF002CXN POLR2A 5:137089993..137090489
ENCFF002CXO POLR2A 5:137089927..137090123
ENCFF002CXO POLR2A 5:137090028..137090452
ENCFF002CXP POLR2A 5:137089836..137090148
ENCFF002CXP POLR2A 5:137090147..137090392
ENCFF002CXP POLR2A 5:137090476..137090685
ENCFF002CXR POLR2A 5:137089828..137090418
ENCFF002CZC POLR2A 5:137089750..137090768
ENCFF002CZD POLR2A 5:137089624..137090750
ENCFF002CZQ POLR2A 5:137089876..137090263
ENCFF002CZQ POLR2A 5:137090419..137090643
ENCFF002CZW POLR2A 5:137089644..137090768
ENCFF002CZY POLR2A 5:137089816..137090685
ENCFF002DAE POLR2A 5:137089896..137090087
ENCFF002DAE POLR2A 5:137090368..137090678
ENCFF002DAH POLR2A 5:137089940..137090115
ENCFF002DAH POLR2A 5:137090352..137090636
ENCFF002DAK POLR2A 5:137089948..137090075
ENCFF002DAK POLR2A 5:137089980..137090480
ENCFF002DAS POLR2A 5:137089955..137090100
ENCFF002DAS POLR2A 5:137089995..137090471
ENCFF002DAV POLR2A 5:137090164..137090381
ENCFF002DAV POLR2A 5:137090196..137090740
ENCFF002DAY POLR2A 5:137089892..137090134
ENCFF002DAY POLR2A 5:137089950..137090586
ENCFF002DAY POLR2A 5:137090150..137090786
ENCFF002DBB POLR2A 5:137089903..137090103
ENCFF002DBB POLR2A 5:137090440..137090640
ENCFF002DBE POLR2A 5:137089853..137090322
ENCFF002DBE POLR2A 5:137090141..137090637
ENCFF002DBO POLR2A 5:137089835..137090163
ENCFF002DBO POLR2A 5:137090119..137090413
ENCFF002DBP POLR2A 5:137089866..137090135
ENCFF002DBP POLR2A 5:137090209..137090363
ENCFF002DBP POLR2A 5:137090312..137090642
ENCFF002DBQ POLR2A 5:137089919..137090092
ENCFF002DBQ POLR2A 5:137090043..137090413
ENCFF002DBT POLR2A 5:137089949..137090114
ENCFF002DBT POLR2A 5:137090364..137090734
3 EST(s) were mapped to retro_hsap_34 retrocopy
EST ID Start End Identity Match Mis-match Score
AW614422 137089215 137089515 100 300 0 300
BE394303 137088945 137089338 98.5 392 1 389
BF900701 137089161 137089404 97.9 230 4 221


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr ≤ 1 1 < Expr ≤ 5 5 < Expr ≤ 10 Expr > 10
TSS #1 TSS_1491992 libraries 0 libraries 1 library 0 libraries 1826 libraries

The graphical summary, for retro_hsap_34 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

retro_hsap_34 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_34 has 3 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Gorilla gorilla retro_ggor_14
Bos taurus retro_btau_212
Canis familiaris retro_cfam_65

Parental genes homology:
Parental genes homology involve 18 parental genes, and 119 retrocopies.

Species Parental gene accession Retrocopies number
Bos taurus ENSBTAG000000215808 retrocopies
Dasypus novemcinctus ENSDNOG000000190223 retrocopies
Ficedula albicollis ENSFALG000000032151 retrocopy
Felis catus ENSFCAG000000121465 retrocopies
Homo sapiens ENSG0000013548657 retrocopies
Homo sapiens ENSG000001386681 retrocopy
Homo sapiens ENSG00000170144 11 retrocopies
Homo sapiens ENSG000001974511 retrocopy
Gallus gallus ENSGALG000000092501 retrocopy
Gorilla gorilla ENSGGOG000000061306 retrocopies
Macropus eugenii ENSMEUG000000136226 retrocopies
Macaca mulatta ENSMMUG000000018584 retrocopies
Mus musculus ENSMUSG000000590056 retrocopies
Oryctolagus cuniculus ENSOCUG000000027432 retrocopies
Pelodiscus sinensis ENSPSIG000000030111 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000251254 retrocopies
Xenopus tropicalis ENSXETG000000018061 retrocopy
Xiphophorus maculatus ENSXMAG000000004391 retrocopy

Expression level across human populations :

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2089

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2112

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2135

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2158

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2181

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2204

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2227

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2250

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2273

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2296

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2325

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2348

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2371

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2394

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2417

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2440

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2463

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2486

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2509

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2532

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2553

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2576

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2599

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2622

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2645

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2668

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2691

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2714

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2737

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2760

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2787

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2810

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2837

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2860

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2887

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2910

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2937

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2960

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2987

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3010

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3122

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3145

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3168

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3191

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3214

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3241

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3264

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3287

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3310

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3333

Notice: Undefined variable: populLEGEND in /home/retrogenedb/www/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM
Could not execute MySQL populData: