Parental gene: | TOMM20, ENSTBEG00000003827 |
| Aliases: | None |
| Description: | translocase of outer mitochondrial membrane 20 homolog (yeast) [Source:HGNC Symbol;Acc:20947] |
| Organism: | Treeshrew (Tupaia belangeri) |
| Coordinates: | GeneScaffold_3735:83131..116357(-) |
>ENSTBEG00000003827
ATGGTGGGCCAAAACAGCACCACAACCACCTCTGGGGTGTGCCAGGCCCTGTTCATCTGCTACTGCATTTACTTTGATAA
GCACAGGATTGACCTCAACTTCAACAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACCTG
ACCTTAGAGATGCTGAGGCAGTTCAGAAATTCCTTGAAGAGATACAGCTTGAAGAGCTGCTAGCNNNNNGTGAGTACGAG
AAGGGTGTGGACCACCTGACCAACGCCATCGCCGTGTGTGGGCAGCCGCAGCAGTTGCTGCAGGTGTTGCAGCAGACGCT
GCCACCTCCTGTGTTCCAGATGCTGCTGACCAAGCTCCCGACCATCAGTCAGAGAATTGTAAGTGCTCAGAGCTTGGCTG
AAGATGATGTGGAGTGA
| Species | Parental gene accession | Homology type | Retrogenes number | |
|---|---|---|---|---|
| Bos taurus | ENSBTAG00000000562 | ortholog_one2many | 5 retrogenes | |
| Choloepus hoffmanni | ENSCHOG00000002383 | ortholog_one2one | 7 retrogenes | |
| Callithrix jacchus | ENSCJAG00000018127 | ortholog_one2one | 3 retrogenes | |
| Erinaceus europaeus | ENSEEUG00000000221 | ortholog_one2one | 1 retrogene | |
| Echinops telfairi | ENSETEG00000017693 | ortholog_one2one | 4 retrogenes | |
| Homo sapiens | ENSG00000173726 | ortholog_one2one | 5 retrogenes | |
| Gorilla gorilla | ENSGGOG00000025184 | ortholog_one2one | 5 retrogenes | |
| Loxodonta africana | ENSLAFG00000015499 | ortholog_one2one | 1 retrogene | |
| Microcebus murinus | ENSMICG00000016325 | ortholog_one2one | 3 retrogenes | |
| Myotis lucifugus | ENSMLUG00000016218 | ortholog_one2one | 1 retrogene | |
| Macaca mulatta | ENSMMUG00000007136 | ortholog_one2many | 2 retrogenes | |
| Monodelphis domestica | ENSMODG00000008452 | ortholog_one2many | 6 retrogenes | |
| Mus musculus | ENSMUSG00000093904 | ortholog_one2one | 12 retrogenes | |
| Oryctolagus cuniculus | ENSOCUG00000021470 | ortholog_one2one | 2 retrogenes | |
| Otolemur garnettii | ENSOGAG00000032693 | ortholog_one2one | 2 retrogenes | |
| Pongo abelii | ENSPPYG00000000099 | ortholog_one2one | 4 retrogenes | |
| Pan troglodytes | ENSPTRG00000002127 | ortholog_one2one | 5 retrogenes | |
| Pteropus vampyrus | ENSPVAG00000015157 | ortholog_one2one | 1 retrogene | |
| Rattus norvegicus | ENSRNOG00000019980 | ortholog_one2one | 4 retrogenes | |
| Sarcophilus harrisii | ENSSHAG00000015876 | ortholog_one2one | 3 retrogenes | |
| Ictidomys tridecemlineatus | ENSSTOG00000027564 | ortholog_one2many | 3 retrogenes | |
| Tursiops truncatus | ENSTTRG00000002200 | ortholog_one2one | 4 retrogenes | |
| Vicugna pacos | ENSVPAG00000003980 | ortholog_one2one | 1 retrogene |
| # | RetrogeneDB ID | Identity (%) | Coverage (%) | ORF conservation | Expression evidence | RDV |
|---|---|---|---|---|---|---|
| 1. | retro_tbel_600 | 80.90 | 63.04 | Please wait, loading  |
Please wait, loading |
Please wait, loading |
| 2. | retro_tbel_1483 | 65.56 | 60.87 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 3. | retro_tbel_2215 | 73.33 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 4. | retro_tbel_2239 | 73.81 | 59.42 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 5. | retro_tbel_2240 | 76.40 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 6. | retro_tbel_2340 | 63.64 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 7. | retro_tbel_2348 | 76.40 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 8. | retro_tbel_2440 | 67.42 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 9. | retro_tbel_2472 | 56.82 | 90.58 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 10. | retro_tbel_2548 | 72.29 | 58.70 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 11. | retro_tbel_2610 | 78.31 | 58.70 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 12. | retro_tbel_2619 | 75.28 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 13. | retro_tbel_3000 | 76.40 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 14. | retro_tbel_3182 | 74.16 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 15. | retro_tbel_3204 | 70.59 | 60.14 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 16. | retro_tbel_3674 | 73.03 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 17. | retro_tbel_3687 | 83.70 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 18. | retro_tbel_3729 | 76.40 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 19. | retro_tbel_3808 | 75.28 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 20. | retro_tbel_3895 | 56.06 | 90.58 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 21. | retro_tbel_3949 | 76.40 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 22. | retro_tbel_4068 | 74.16 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 23. | retro_tbel_4096 | 74.16 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 24. | retro_tbel_4136 | 73.33 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 25. | retro_tbel_4596 | 74.16 | 63.04 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 26. | retro_tbel_4625 | 77.11 | 58.70 | Please wait, loading |
Please wait, loading |
Please wait, loading |
Download FASTA sequences of all ENSTBEG00000003827 retrocopies