RetrogeneDB ID:

retro_pabe_588

Retrocopy
location
Organism:Orangutan (Pongo abelii)
Coordinates:10:49118312..49118618(-)
Located in intron of:ENSPPYG00000002273
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:ACP1
Ensembl ID:ENSPPYG00000012694
Aliases:None
Description:Low molecular weight phosphotyrosine protein phosphatase [Source:UniProtKB/Swiss-Prot;Acc:Q5REM7]


Retrocopy-Parental alignment summary:






>retro_pabe_588
GATTGCAGAGAGGAAAATTGCATGAAGAAGCATGGTATGCCCATGAATCACATGGCTCAGCAGATTATCAAGGAAGACTT
TACCACATTTGATTATATACTATATATCAATGAAAGCAACTTGAGAGATTTGAATAGAAAATTTCCTCAAGTTAAAAACT
GCAAAGCTAAAATTGAACTACTTGGGTGCTATGATCTACCAAAACAACCTGCTATTGAAAACCCCTGTTAAGGGAATGAC
CCTGACTTTGAGATGGTGTACCAGCAATGTGTCAGGTGCTGCAGAGCATTCTTGGAAAAGGCCCAC

ORF - retro_pabe_588 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 72.55 %
Parental protein coverage: 64.97 %
Number of stop codons detected: 1
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalDYRGQSCMKRHGIPMSHVARQITREDFATFDYILCMDESNLRDLNRKSNQVKTCKAKIELLGSYDPQKQL
D.R...CMK.HG.PM.H.A.QI..EDF.TFDYIL...ESNLRDLNRK..QVK.CKAKIELLG.YD..KQ.
RetrocopyDCREENCMKKHGMPMNHMAQQIIKEDFTTFDYILYINESNLRDLNRKFPQVKNCKAKIELLGCYDLPKQP
ParentalIIEDPYYGNDSDFETVYQQCVRCCRAFLEKAH
.IE.P..GND.DFE.VYQQCVRCCRAFLEKAH
RetrocopyAIENPC*GNDPDFEMVYQQCVRCCRAFLEKAH

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
SRP007412_brain_prefrontal_cortex 0 .00 RPM 36 .49 RPM
SRP007412_cerebellum 0 .00 RPM 27 .48 RPM
SRP007412_heart 0 .00 RPM 14 .09 RPM
SRP007412_kidney 0 .00 RPM 29 .47 RPM
SRP007412_liver 0 .00 RPM 23 .32 RPM
Pongo abelii was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_pabe_588 retrocopy.
Pongo abelii was not studied using FANTOM5 data.
retro_pabe_588 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_pabe_588 has 4 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Homo sapiens retro_hsap_603
Pan troglodytes retro_ptro_446
Gorilla gorilla retro_ggor_532
Macaca mulatta retro_mmul_2447

Parental genes homology:
Parental genes homology involve 25 parental genes, and 250 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG000000095542 retrocopies
Bos taurus ENSBTAG000000204984 retrocopies
Choloepus hoffmanni ENSCHOG0000000389194 retrocopies
retro_chof_1010, retro_chof_1053, retro_chof_1073, retro_chof_1099, retro_chof_1100, retro_chof_1144, retro_chof_119, retro_chof_1190, retro_chof_121, retro_chof_1259, retro_chof_1265, retro_chof_1275, retro_chof_1330, retro_chof_1351, retro_chof_1359, retro_chof_1389, retro_chof_1390, retro_chof_1412, retro_chof_142, retro_chof_1444, retro_chof_1447, retro_chof_1508, retro_chof_1567, retro_chof_1570, retro_chof_1593, retro_chof_1632, retro_chof_1633, retro_chof_1658, retro_chof_1684, retro_chof_169, retro_chof_1698, retro_chof_17, retro_chof_1716, retro_chof_174, retro_chof_1799, retro_chof_1802, retro_chof_1815, retro_chof_1833, retro_chof_1838, retro_chof_1864, retro_chof_1941, retro_chof_1956, retro_chof_1993, retro_chof_2012, retro_chof_2041, retro_chof_2044, retro_chof_2091, retro_chof_2165, retro_chof_2192, retro_chof_2208, retro_chof_2228, retro_chof_2259, retro_chof_2344, retro_chof_2378, retro_chof_2384, retro_chof_2443, retro_chof_245, retro_chof_2478, retro_chof_2512, retro_chof_2532, retro_chof_2542, retro_chof_2551, retro_chof_261, retro_chof_262, retro_chof_2622, retro_chof_2636, retro_chof_2643, retro_chof_2653, retro_chof_2654, retro_chof_2678, retro_chof_2701, retro_chof_2705, retro_chof_2707, retro_chof_319, retro_chof_377, retro_chof_460, retro_chof_598, retro_chof_603, retro_chof_649, retro_chof_650, retro_chof_66, retro_chof_727, retro_chof_80, retro_chof_803, retro_chof_83, retro_chof_842, retro_chof_934, retro_chof_939, retro_chof_958, retro_chof_962, retro_chof_986, retro_chof_991, retro_chof_994, retro_chof_999,
Callithrix jacchus ENSCJAG000000116635 retrocopies
Dasypus novemcinctus ENSDNOG0000001738232 retrocopies
Equus caballus ENSECAG000000100791 retrocopy
Echinops telfairi ENSETEG0000001376418 retrocopies
Felis catus ENSFCAG000000267171 retrocopy
Homo sapiens ENSG000001437275 retrocopies
Gorilla gorilla ENSGGOG000000155775 retrocopies
Loxodonta africana ENSLAFG000000029664 retrocopies
Macropus eugenii ENSMEUG000000107333 retrocopies
Myotis lucifugus ENSMLUG000000177074 retrocopies
Macaca mulatta ENSMMUG000000170972 retrocopies
Monodelphis domestica ENSMODG000000257643 retrocopies
Mustela putorius furoENSMPUG000000127872 retrocopies
Mus musculus ENSMUSG0000004457311 retrocopies
Nomascus leucogenys ENSNLEG000000083596 retrocopies
Oryctolagus cuniculus ENSOCUG0000001287611 retrocopies
Otolemur garnettii ENSOGAG000000003015 retrocopies
Pongo abelii ENSPPYG00000012694 6 retrocopies
Pan troglodytes ENSPTRG000000116055 retrocopies
Rattus norvegicus ENSRNOG0000000526011 retrocopies
Ictidomys tridecemlineatus ENSSTOG000000025203 retrocopies
Tarsius syrichta ENSTSYG000000048647 retrocopies





Copyright © RetrogeneDB 2014-2017