RetrogeneDB ID:

retro_oniv_49

Retrocopy
location
Organism:Indian wild rice (Oryza nivara)
Coordinates:6:2772472..2772715(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ONIVA07G23000
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_oniv_49
ATGGGGAAGAGGAAGTCTCGGGTGTCGAAGATGCTGGCGACGGCGAAGAAGGCGGCGCCGAAGCTGGAGACGGCGTTCAG
CTGCCCGTTCTGCGACCACGGCGGCGCGGTGGAGTGCAGCATCGACATCAAGCACATGATCGCCGTGGCCTCCTGCTTCG
TCTGCCAGGCGCGCTACTCCACCACCGCCCACGCGCTCACCGAGCCCATCGACGTCTACAGCGAGTGGATCGACCAGTGC
GAG

ORF - retro_oniv_49 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 60.49 %
Parental protein coverage: 87.64 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalMGKRK---SAAKPPPKKRMDKLDTVFSCPFCNHGSSVECRIDMKNLIGEASCRICQENFSTTVNALTEPI
MGKRK...S......KK...KL.T.FSCPFC.HG..VEC.ID.K..I..ASC..CQ...STT..ALTEPI
RetrocopyMGKRKSRVSKMLATAKKAAPKLETAFSCPFCDHGGAVECSIDIKHMIAVASCFVCQARYSTTAHALTEPI
ParentalDIYSEWIDECE
D.YSEWID.CE
RetrocopyDVYSEWIDQCE

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza nivara was not studied using RNA-Seq expression data.
Oryza nivara was not studied using ChIP-Seq data.
Oryza nivara was not studied using EST data.
Oryza nivara was not studied using FANTOM5 data.
retro_oniv_49 was not experimentally validated.

Retrocopy orthology:
Oryza nivara does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 10 parental genes, and 14 retrocopies.

Species Parental gene accession Retrocopies number
Oryza sativa indicaBGIOSGA0078781 retrocopy
Aegilops tauschii F775_280851 retrocopy
Hordeum vulgare MLOC_149073 retrocopies
Oryza barthii OBART07G231401 retrocopy
Oryza glumaepatula OGLUM07G232001 retrocopy
Oryza nivara ONIVA07G23000 1 retrocopy
retro_oniv_49 ,
Oryza sativa japonicaOS07G06311001 retrocopy
Sorghum bicolor Sb10g0037101 retrocopy
Setaria italica Si007595m.g2 retrocopies
Triticum aestivum Traes_1DL_84C83461E2 retrocopies



Copyright © RetrogeneDB 2014-2017