Parental gene:

ONIVA07G23000

Aliases:None
Description:None
Organism:Indian wild rice (Oryza nivara)
Coordinates:7:21410997..21413660(+)


>ONIVA07G23000
ATGGGAAAGAGGAAGTCAGCGGCTAAGCCACCACCTAAGAAGAGGATGGACAAGCTTGATACTGTATTTTCCTGCCCATT
CTGCAATCATGGCAGTAGTGTTGAATGCCGGATTGATATGAAGAACCTGATCGGCGAGGCTTCATGTAGGATCTGTCAGG
AAAACTTCAGCACCACTGTCAATGCACTGACTGAACCAATCGACATATATAGCGAATGGATTGATGAGTGCGAGCGTGTC
AACAATGTCGAAGACGACGACGGAGCATGA

Species Parental gene accession Homology type Retrogenes number
Oryza sativa indica BGIOSGA007878 ortholog_one2one 1 retrogene
Aegilops tauschii F775_28085 ortholog_one2many 1 retrogene
Hordeum vulgare MLOC_14907 ortholog_one2one 3 retrogenes
Oryza barthii OBART07G23140 ortholog_one2one 1 retrogene
Oryza glumaepatula OGLUM07G23200 ortholog_one2one 1 retrogene
Oryza sativa japonica OS07G0631100 ortholog_one2one 1 retrogene
Sorghum bicolor Sb10g003710 ortholog_one2one 1 retrogene
Setaria italica Si007595m.g ortholog_one2one 2 retrogenes
Triticum aestivum Traes_1DL_84C83461E ortholog_one2many 2 retrogenes

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_oniv_49 60.49 87.64
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ONIVA07G23000 retrocopies