RetrogeneDB ID:

retro_obar_8

Retrocopy
location
Organism:Oryza barthii
Coordinates:6:24492235..24493186(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:OBART06G26620
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:OBART05G14050
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_obar_8
ATGGACGCCAACATGCTGAGCGCGATGATGGCCGCCGTCGGCGGCGACAGGGCGGCGGCGCCGGGCGGCGACAAGCCGCA
GCCGGACACGTCGGAGCAGATCAACGTGTCCCCCCTCGCCCTCCTCAAGATGCTCAAGCACGGGCGAGCCGGCGTGCCGA
TGGAGGTGATGGGGCTGATGCTGGGCGAGTTCGTCGACGAGTACACGGTGACGGTCGCCGACGTGTTCGCCATGCCGCAG
AGCGGCACCGGCGTGAGCGTGGAGGCGGTGGACCACGCGTTCCAGAGCGAGATGCTGGAGATGCTCCGGCAGACGGGGCG
GCCGGAGATGGTGGTGGGGTGGTACCACTCCCACCCCGGCTTCGGCTGCTGGCTCTCCGGCACCGACATGGCCACGCAGC
AGAGCTTCGAGCAGCTGCACCCGCGCGCCGTCGCCGTGGTGATCGACCCGGTGCAGAGCGTCAAGGGGAAGGTGGTCATG
GACGCGTTCCGCCTCGTCGACCACATGGCGATGGTGCTCGGCGGCGGCGCGGGCGGCGAGGCGCGGCAGACCACGTCGAA
CGTCGGCGCCGTCGCGCGGCCGTCGGCGGTGGCGCTCGTCCACGGCCTCGGGCGGCACTACTACTCGCTCGCCATCAGCT
ACCGGATGAAGGAGGGGGAGGAGCGGATGCTGGCGTGCCTCAGCCGGGGCGGGTGGTCCGACGGGTTCGCGCTGCGGCGG
TTCGGCGCGCACGACGCCGGGAACGAGGCGGCGGTGCGCGGGATGCGGGACCTCGCCGTGGGCTACGGGGCGCAGGTGAG
GGAGGAGGACGAGACGCCGCCGGAGAGGCTCGCCGTGGTGAGGGCAGGCAAGGTGGACGCCAAGGGGAAGCTGGAGGAGA
AGGCCATGGACGCCATGTCCGCCAACATCGTGCAGACGCTCGGCATGATGCTCGACACCGTCACCTTCTAG

ORF - retro_obar_8 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 66.34 %
Parental protein coverage: 97.39 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalGASGMGQPPSDSPLLDSSEQVYISSLALLKMLKHGRAGVPMEVMGLMLGEFVDDYTVRVVDVFAMPQSGT
G......P..D.P..D.SEQ...S.LALLKMLKHGRAGVPMEVMGLMLGEFVD.YTV.V.DVFAMPQSGT
RetrocopyGGDRAAAPGGDKPQPDTSEQINVSPLALLKMLKHGRAGVPMEVMGLMLGEFVDEYTVTVADVFAMPQSGT
ParentalGVSVEAVDHVFQTNMLDMLKQTGRPEMVVGWYHSHPGFGCWLSGVDINTQQSFEALNPRAVAVVIDPIQS
GVSVEAVDH.FQ..ML.ML.QTGRPEMVVGWYHSHPGFGCWLSG.D..TQQSFE.L.PRAVAVVIDP.QS
RetrocopyGVSVEAVDHAFQSEMLEMLRQTGRPEMVVGWYHSHPGFGCWLSGTDMATQQSFEQLHPRAVAVVIDPVQS
ParentalVKGKVVIDAFRLINPQTMML----GQEPRQTTSNVGHLNKPSIQALIHGLNRHYYSIAINYRKNELEEKM
VKGKVV.DAFRL.....M.L....G.E.RQTTSNVG....PS..AL.HGL.RHYYS.AI.YR..E.EE.M
RetrocopyVKGKVVMDAFRLVDHMAMVLGGGAGGEARQTTSNVGAVARPSAVALVHGLGRHYYSLAISYRMKEGEERM
ParentalLLNLHKKKWTDGLILKRFDTHSKTNEQTVQEMLNLAIKYNKAVQEEDELPPEKLAIANVGRQDAKKHLEE
L..L....W.DG..L.RF..H...NE..V..M..LA..Y...V.EEDE.PPE.LA....G..DAK..LEE
RetrocopyLACLSRGGWSDGFALRRFGAHDAGNEAAVRGMRDLAVGYGAQVREEDETPPERLAVVRAGKVDAKGKLEE
ParentalHVSNLMSSNIVQTLGTMLDTVVF
.....MS.NIVQTLG.MLDTV.F
RetrocopyKAMDAMSANIVQTLGMMLDTVTF

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza barthii was not studied using RNA-Seq expression data.
Oryza barthii was not studied using ChIP-Seq data.
Oryza barthii was not studied using EST data.
Oryza barthii was not studied using FANTOM5 data.
retro_obar_8 was not experimentally validated.

Retrocopy orthology:
Oryza barthii does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 9 parental genes, and 9 retrocopies.

Species Parental gene accession Retrocopies number
Aegilops tauschii F775_300291 retrocopy
Hordeum vulgare MLOC_372951 retrocopy
Oryza barthii OBART05G14050 1 retrocopy
retro_obar_8 ,
Oryza glumaepatula OGLUM05G149101 retrocopy
Oryza nivara ONIVA05G146001 retrocopy
Oryza punctata OPUNC05G122301 retrocopy
Oryza glaberrima ORGLA05G02478001 retrocopy
Oryza rufipogon ORUFI05G151501 retrocopy
Oryza sativa japonicaOS05G03712001 retrocopy



Copyright © RetrogeneDB 2014-2017