Parental gene:

OS05G0371200

Aliases:None
Description:Os05g0371200 protein; Putative 26S proteasome non-ATPase regulatory subunit 14; cDNA clone:006-302-D04, full insert sequence; cDNA clone:006-309-B06, full insert sequence; cDNA clone:J023062E06, full insert sequence [Source:UniProtKB/TrEMBL;Acc:Q60EW3]
Organism:Rice subsp. japonica (Oryza sativa japonica)
Coordinates:5:17870103..17873680(+)


>OS05G0371200
ATGGAGCGGCTGCAGCGGATCTTCGGCGCCTCCGGCATGGGGCAGCCGCCGTCGGACTCGCCGCTGCTCGACTCCTCCGA
GCAGGTCTACATCTCCTCCCTCGCCCTCCTCAAGATGCTCAAGCACGGGAGGGCCGGCGTGCCGATGGAGGTGATGGGGC
TGATGCTGGGGGAGTTCGTCGACGACTACACGGTCAGGGTGGTCGACGTCTTCGCCATGCCGCAGAGCGGGACCGGGGTC
AGCGTCGAGGCCGTCGACCATGTCTTCCAGACCAACATGCTCGACATGCTCAAGCAGACCGGGAGGCCAGAAATGGTGGT
AGGTTGGTACCATTCCCATCCTGGATTTGGTTGCTGGCTTTCAGGAGTTGACATCAATACTCAACAGAGTTTTGAAGCTT
TAAACCCCAGGGCAGTTGCCGTCGTGATAGATCCCATCCAAAGTGTCAAGGGGAAAGTTGTCATTGATGCATTTCGCCTT
ATTAACCCTCAGACCATGATGCTTGGTCAGGAGCCACGACAGACAACATCAAATGTTGGGCACCTAAATAAGCCATCTAT
TCAGGCTCTTATTCATGGGCTGAACAGGCACTACTATTCAATTGCAATCAATTACCGGAAAAATGAGCTTGAGGAAAAGA
TGTTACTGAACTTGCACAAAAAGAAATGGACCGATGGATTGATTCTGAAGAGGTTTGACACTCATTCAAAGACCAATGAG
CAGACTGTTCAGGAAATGCTGAACCTTGCTATCAAGTACAACAAGGCGGTGCAAGAGGAGGATGAGCTGCCGCCTGAGAA
ATTAGCGATAGCAAATGTGGGACGGCAAGATGCTAAGAAGCACTTGGAAGAGCATGTCTCCAATTTGATGTCATCAAACA
TAGTTCAGACGCTAGGAACCATGCTCGATACAGTTGTATTTTAG

Species Parental gene accession Homology type Retrogenes number
Aegilops tauschii F775_30029 ortholog_one2one 1 retrogene
Hordeum vulgare MLOC_37295 ortholog_one2one 1 retrogene
Oryza barthii OBART05G14050 ortholog_one2one 1 retrogene
Oryza glumaepatula OGLUM05G14910 ortholog_one2one 1 retrogene
Oryza nivara ONIVA05G14600 ortholog_one2one 1 retrogene
Oryza punctata OPUNC05G12230 ortholog_one2one 1 retrogene
Oryza glaberrima ORGLA05G0247800 ortholog_one2one 1 retrogene
Oryza rufipogon ORUFI05G15150 ortholog_one2one 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_osat_40 67.92 94.14
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all OS05G0371200 retrocopies