RetrogeneDB ID:

retro_chof_1199

Retrocopy
location
Organism:Sloth (Choloepus hoffmanni)
Coordinates:scaffold_223244:1007..1384(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ENSCHOG00000001394
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_chof_1199
AAGTACCCAGACATCCACAATGAAGGAGAGAATTACCTCCCTCAACCTACATATAGACACATAATGTCTTTCCTGTCAGT
CTTCAAACTAGTATTAATAGGCTTAATAATTGTTGGCAAGGATCTCTTTGTTTTCTTTGGTATGCAAGCTCCTAGCACCT
GGCAGTGGGGCCAAGAAATTAAGGTCTATACATGTATGACGGTTTTCTTGGGCAACATGGTTGAGAACCAGTGTATGTCA
ACAGGTGCATTTGAGATAACTTTAAATGATGTACTGTGTGGTCTAAGCTGGAATCTGGTCACCTTCCATTCATACAACAG
CTTGTTTAAATTCCTGACACTGAAATGAAGCTCAATGTACACATGGGGTTCAAGCCC

ORF - retro_chof_1199 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 79.69 %
Parental protein coverage: 67.2 %
Number of stop codons detected: 1
Number of frameshifts detected 1


Retrocopy - Parental Gene Alignment:

ParentalRYPDIRIEGENYLPQPIYRHIASFLSVFKLVLIGLIIVGKDPFAFFGMQAPSIWQWGQENKVYACMMVFF
.YPDI..EGENYLPQP.YRHI.SFLSVFKLVLIGLIIVGKD.F.FFGMQAPS.WQWGQE.KVY.CM.V.F
RetrocopyKYPDIHNEGENYLPQPTYRHIMSFLSVFKLVLIGLIIVGKDLFVFFGMQAPSTWQWGQEIKVYTCMTV-F
ParentalLSSMLENLCMSTGAFEITLNDV-PVWSKLESGHLPSMQQLVQILDNEMKLNVHMDSLP
L..M.EN.CMSTGAFEITLNDV..VWSKLESGHLP..QQLV.I.D.EMKLNVHM...P
RetrocopyLGNMVENQCMSTGAFEITLNDV<TVWSKLESGHLPFIQQLV*IPDTEMKLNVHMGFKP

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Choloepus hoffmanni was not studied using RNA-Seq expression data.
Choloepus hoffmanni was not studied using ChIP-Seq data.
Choloepus hoffmanni was not studied using EST data.
Choloepus hoffmanni was not studied using FANTOM5 data.
retro_chof_1199 was not experimentally validated.

Retrocopy orthology:
Choloepus hoffmanni does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 13 parental genes, and 22 retrocopies.

Species Parental gene accession Retrocopies number
Choloepus hoffmanni ENSCHOG00000001394 2 retrocopies
retro_chof_1199 , retro_chof_768,
Equus caballus ENSECAG000000251232 retrocopies
Homo sapiens ENSG000001988432 retrocopies
Gorilla gorilla ENSGGOG000000282911 retrocopy
Macropus eugenii ENSMEUG000000147383 retrocopies
Monodelphis domestica ENSMODG000000212731 retrocopy
Mus musculus ENSMUSG000000757001 retrocopy
Nomascus leucogenys ENSNLEG000000032842 retrocopies
Ochotona princeps ENSOPRG000000144252 retrocopies
Pan troglodytes ENSPTRG000000395811 retrocopy
Rattus norvegicus ENSRNOG000000135071 retrocopy
Sarcophilus harrisii ENSSHAG000000185061 retrocopy
Tarsius syrichta ENSTSYG000000074103 retrocopies



Copyright © RetrogeneDB 2014-2017