RetrogeneDB ID:

retro_hsap_2703

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:3:130012123..130012454(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000249253
Aliases:None
Status:KNOWN_PSEUDOGENE
Parental gene
information
Parental gene summary:
Parental gene symbol:ATP5G2
Ensembl ID:ENSG00000135390
Aliases:ATP5G2, ATP5A
Description:ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) [Source:HGNC Symbol;Acc:842]


Retrocopy-Parental alignment summary:






>retro_hsap_2703
CTCTACCTTCTCTGCACTGAAAGCAACTGTGTTCCCAAAGCCCCTCACCCCTAAAAATGTACAGCTGCTCCAAGTGTGCC
TCCACCCACTCTTGGTCAAGAGTACCTCCCAGTTGCTGAGCTGCCTACTATCTGCAGTGGTGATGAAATGACCAGAGACA
CTGACAGATGAGAGCCTCAGCAGCTTGGCAGTCTCACATCCCCTTATCTCACTTGTCCCTACCTGCAACTTCCAAACCAG
TGCAATTTCAAGAGACATTGACACAGCAGCCAAGTTTATTGGAGTTGGGGCTGCTACAGTTGGGGTGGCTGGCTCTGGGG
CAGGGATTGGT

ORF - retro_hsap_2703 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 76.11 %
Parental protein coverage: 56.06 %
Number of stop codons detected: 1
Number of frameshifts detected 2


Retrocopy - Parental Gene Alignment:

ParentalLCLLCSGSSSPATAPHP-LKMFACSKFVST-PSLVKSTSQLLSRPLSAVVLKRPEILTDESLSSLAVSCP
L.LLC..S.....APHP.LKM..CSK..ST.P.LVKSTSQLLS..LSAVV.K.PE.LTDESLSSLAVS.P
RetrocopyLYLLCTESNCVPKAPHP<LKMYSCSKCAST<PLLVKSTSQLLSCLLSAVVMK*PETLTDESLSSLAVSHP
ParentalLTSLVSSRSFQTSAISRDIDTAAKFIGAGAATVGVAGSGAGIG
L.SLV....FQTSAISRDIDTAAKFIG.GAATVGVAGSGAGIG
RetrocopyLISLVPTCNFQTSAISRDIDTAAKFIGVGAATVGVAGSGAGIG

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






RNA-Seq - click to see more details

(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 0 .00 RPM 86 .67 RPM
bodymap2_adrenal 0 .00 RPM 112 .27 RPM
bodymap2_brain 0 .00 RPM 54 .31 RPM
bodymap2_breast 0 .00 RPM 76 .69 RPM
bodymap2_colon 0 .00 RPM 134 .38 RPM
bodymap2_heart 0 .00 RPM 118 .41 RPM
bodymap2_kidney 0 .00 RPM 105 .84 RPM
bodymap2_liver 0 .00 RPM 69 .73 RPM
bodymap2_lung 0 .00 RPM 89 .06 RPM
bodymap2_lymph_node 0 .00 RPM 91 .95 RPM
bodymap2_ovary 0 .00 RPM 99 .58 RPM
bodymap2_prostate 0 .00 RPM 163 .62 RPM
bodymap2_skeletal_muscle 0 .00 RPM 175 .29 RPM
bodymap2_testis 0 .00 RPM 74 .07 RPM
bodymap2_thyroid 0 .00 RPM 92 .97 RPM
bodymap2_white_blood_cells 0 .00 RPM 161 .58 RPM

ChIP-Seq - click to see more details

RNA Polymerase II actvity near the 5' end of retro_hsap_2703 was not detected

EST - click to see more details

No EST(s) were mapped for retro_hsap_2703 retrocopy.

TSS - click to see more details

No TSS is located nearby retro_hsap_2703 retrocopy 5' end.

Lab - click to see more details

retro_hsap_2703 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_2703 has 3 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Pan troglodytes retro_ptro_1824
Pongo abelii retro_pabe_2255
Macaca mulatta retro_mmul_1539
Parental genes homology:
Parental genes homology involve 30 parental genes, and 259 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG0000000061918 retrocopies
retro_amel_1077, retro_amel_1113, retro_amel_1166, retro_amel_1309, retro_amel_1317, retro_amel_1322, retro_amel_1323, retro_amel_1610, retro_amel_1851, retro_amel_209, retro_amel_227, retro_amel_244, retro_amel_342, retro_amel_363, retro_amel_578, retro_amel_632, retro_amel_770, retro_amel_919,
Bos taurus ENSBTAG0000000573511 retrocopies
retro_btau_1405, retro_btau_1414, retro_btau_733, retro_btau_734, retro_btau_735, retro_btau_737, retro_btau_739, retro_btau_740, retro_btau_741, retro_btau_742, retro_btau_994,
Cavia porcellus ENSCPOG000000228893 retrocopies
retro_cpor_1495, retro_cpor_268, retro_cpor_492,
Equus caballus ENSECAG000000230212 retrocopies
retro_ecab_373, retro_ecab_793,
Erinaceus europaeus ENSEEUG000000030511 retrocopy
retro_eeur_79,
Echinops telfairi ENSETEG0000000596840 retrocopies
retro_etel_1001, retro_etel_1007, retro_etel_103, retro_etel_1191, retro_etel_1203, retro_etel_1259, retro_etel_1288, retro_etel_1301, retro_etel_1327, retro_etel_1332, retro_etel_1354, retro_etel_1374, retro_etel_1402, retro_etel_1404, retro_etel_1420, retro_etel_1427, retro_etel_144, retro_etel_1533, retro_etel_1535, retro_etel_1591, retro_etel_1662, retro_etel_1684, retro_etel_1712, retro_etel_1771, retro_etel_2011, retro_etel_2127, retro_etel_2128, retro_etel_2142, retro_etel_2207, retro_etel_2216, retro_etel_260, retro_etel_475, retro_etel_636, retro_etel_639, retro_etel_652, retro_etel_72, retro_etel_735, retro_etel_736, retro_etel_796, retro_etel_847,
Felis catus ENSFCAG0000000150213 retrocopies
retro_fcat_1126, retro_fcat_1345, retro_fcat_1611, retro_fcat_1785, retro_fcat_1952, retro_fcat_226, retro_fcat_351, retro_fcat_353, retro_fcat_363, retro_fcat_405, retro_fcat_668, retro_fcat_958, retro_fcat_999,
Homo sapiens ENSG00000135390 6 retrocopies
retro_hsap_1332, retro_hsap_2195, retro_hsap_2703 , retro_hsap_3782, retro_hsap_4813, retro_hsap_499,
Homo sapiens ENSG000001591998 retrocopies
retro_hsap_1054, retro_hsap_1234, retro_hsap_1397, retro_hsap_1464, retro_hsap_2844, retro_hsap_2882, retro_hsap_597, retro_hsap_686,
Gorilla gorilla ENSGGOG000000156415 retrocopies
retro_ggor_1039, retro_ggor_1737, retro_ggor_1884, retro_ggor_2543, retro_ggor_2999,
Macropus eugenii ENSMEUG0000000466167 retrocopies
retro_meug_1009, retro_meug_1030, retro_meug_113, retro_meug_1180, retro_meug_1187, retro_meug_1238, retro_meug_1258, retro_meug_1261, retro_meug_1265, retro_meug_1272, retro_meug_1284, retro_meug_1297, retro_meug_1322, retro_meug_1328, retro_meug_1361, retro_meug_1389, retro_meug_1413, retro_meug_1602, retro_meug_1626, retro_meug_1639, retro_meug_1653, retro_meug_1709, retro_meug_1752, retro_meug_177, retro_meug_1802, retro_meug_1843, retro_meug_1882, retro_meug_1885, retro_meug_1891, retro_meug_1903, retro_meug_1909, retro_meug_1919, retro_meug_193, retro_meug_1987, retro_meug_2014, retro_meug_2048, retro_meug_206, retro_meug_2073, retro_meug_2111, retro_meug_2115, retro_meug_2122, retro_meug_216, retro_meug_229, retro_meug_230, retro_meug_296, retro_meug_313, retro_meug_345, retro_meug_348, retro_meug_397, retro_meug_485, retro_meug_514, retro_meug_529, retro_meug_567, retro_meug_622, retro_meug_66, retro_meug_721, retro_meug_742, retro_meug_799, retro_meug_800, retro_meug_846, retro_meug_864, retro_meug_865, retro_meug_896, retro_meug_904, retro_meug_935, retro_meug_936, retro_meug_983,
Microcebus murinus ENSMICG000000116864 retrocopies
retro_mmur_175, retro_mmur_373, retro_mmur_905, retro_mmur_977,
Myotis lucifugus ENSMLUG0000001186013 retrocopies
retro_mluc_106, retro_mluc_1215, retro_mluc_1335, retro_mluc_1337, retro_mluc_1496, retro_mluc_1633, retro_mluc_2151, retro_mluc_2186, retro_mluc_2257, retro_mluc_2273, retro_mluc_516, retro_mluc_575, retro_mluc_656,
Macaca mulatta ENSMMUG000000162413 retrocopies
retro_mmul_1539, retro_mmul_2173, retro_mmul_439,
Mustela putorius furoENSMPUG000000059276 retrocopies
retro_mputfur_1650, retro_mputfur_290, retro_mputfur_335, retro_mputfur_631, retro_mputfur_814, retro_mputfur_947,
Mus musculus ENSMUSG000000626831 retrocopy
retro_mmus_6,
Nomascus leucogenys ENSNLEG000000176864 retrocopies
retro_nleu_1576, retro_nleu_2187, retro_nleu_2403, retro_nleu_326,
Oryctolagus cuniculus ENSOCUG000000089334 retrocopies
retro_ocun_1933, retro_ocun_450, retro_ocun_762, retro_ocun_794,
Otolemur garnettii ENSOGAG000000036114 retrocopies
retro_ogar_142, retro_ogar_1620, retro_ogar_166, retro_ogar_2415,
Ochotona princeps ENSOPRG000000029781 retrocopy
retro_opri_671,
Procavia capensis ENSPCAG000000086793 retrocopies
retro_pcap_140, retro_pcap_189, retro_pcap_212,
Pongo abelii ENSPPYG000000045867 retrocopies
retro_pabe_1211, retro_pabe_1212, retro_pabe_2073, retro_pabe_2255, retro_pabe_236, retro_pabe_3088, retro_pabe_3741,
Pan troglodytes ENSPTRG000000050236 retrocopies
retro_ptro_1668, retro_ptro_1824, retro_ptro_2563, retro_ptro_3202, retro_ptro_376, retro_ptro_909,
Pteropus vampyrus ENSPVAG000000122911 retrocopy
retro_pvam_146,
Rattus norvegicus ENSRNOG000000153206 retrocopies
retro_rnor_1286, retro_rnor_1490, retro_rnor_1939, retro_rnor_2699, retro_rnor_2738, retro_rnor_2910,
Sorex araneus ENSSARG000000010277 retrocopies
retro_sara_124, retro_sara_152, retro_sara_377, retro_sara_581, retro_sara_716, retro_sara_73, retro_sara_759,
Sarcophilus harrisii ENSSHAG000000057264 retrocopies
retro_shar_163, retro_shar_417, retro_shar_653, retro_shar_678,
Ictidomys tridecemlineatus ENSSTOG000000082173 retrocopies
retro_itri_1404, retro_itri_399, retro_itri_436,
Tupaia belangeri ENSTBEG000000057484 retrocopies
retro_tbel_1358, retro_tbel_1467, retro_tbel_2095, retro_tbel_789,
Tarsius syrichta ENSTSYG000000034334 retrocopies
retro_tsyr_147, retro_tsyr_795, retro_tsyr_876, retro_tsyr_915,

Expression level across human populations :
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843 No expression ( = 0 RPM ) Legend:


Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM

Indel association:

No indels were associated with its genomic coordinates. Based on Kabza et al. 2015 (PubMed).





Copyright © RetrogeneDB 2014-2017