RetrogeneDB ID:

retro_eeur_58

Retrocopy
location
Organism:Hedgehog (Erinaceus europaeus)
Coordinates:GeneScaffold_3109:7660..7857(+)
Located in intron of:ENSEEUG00000010669
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:RPS27A
Ensembl ID:ENSEEUG00000002329
Aliases:None
Description:ribosomal protein S27a [Source:HGNC Symbol;Acc:10417]


Retrocopy-Parental alignment summary:






>retro_eeur_58
GTGACTGGCAAGACCATCACCCTGGAGATGGAGCCCAGTGATGCCACTAAGAATGTGAAGGTCAAGATCTAGGATAAAGA
AGGCTTCTCCCCTGAGCACCACAGGCTCATCTTTATGACAAGCAGCTGGAAGATAGTTGTACTCTCTCTGACTACAACAT
CCAGAAAGAGTTGAACCTCCATCTGCTCCTCTGCCTG

ORF - retro_eeur_58 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 67.16 %
Parental protein coverage: 63.73 %
Number of stop codons detected: 1
Number of frameshifts detected 1


Retrocopy - Parental Gene Alignment:

ParentalLTGKTITLEVEPSDTIENVKAKIQDK-GIPPDQQRLIFA-GKQLEDGRTLSDYNIQKESTLHLVLRL
.TGKTITLE.EPSD...NVK.KI.DK.G..P...RLIF...KQLED..TLSDYNIQKE..LHL.L.L
RetrocopyVTGKTITLEMEPSDATKNVKVKI*DKEGFSPEHHRLIFM<DKQLEDSCTLSDYNIQKELNLHLLLCL

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
SRP017611_brain 0 .00 RPM 59 .46 RPM
SRP017611_kidney 0 .00 RPM 112 .71 RPM
SRP017611_liver 0 .00 RPM 82 .64 RPM
Erinaceus europaeus was not studied using ChIP-Seq data.
Erinaceus europaeus was not studied using EST data.
Erinaceus europaeus was not studied using FANTOM5 data.
retro_eeur_58 was not experimentally validated.

Retrocopy orthology:
Erinaceus europaeus does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 19 parental genes, and 199 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG000000040175 retrocopies
Canis familiaris ENSCAFG000000234713 retrocopies
Callithrix jacchus ENSCJAG000000100525 retrocopies
Cavia porcellus ENSCPOG000000058197 retrocopies
Dasypus novemcinctus ENSDNOG0000000481312 retrocopies
Dipodomys ordii ENSDORG0000000629111 retrocopies
Erinaceus europaeus ENSEEUG00000002329 9 retrocopies
Gorilla gorilla ENSGGOG000000076789 retrocopies
Loxodonta africana ENSLAFG000000231332 retrocopies
Myotis lucifugus ENSMLUG0000001706410 retrocopies
Myotis lucifugus ENSMLUG000000294491 retrocopy
Macaca mulatta ENSMMUG000000155638 retrocopies
Monodelphis domestica ENSMODG000000018193 retrocopies
Oryctolagus cuniculus ENSOCUG0000000361310 retrocopies
Pongo abelii ENSPPYG000000258711 retrocopy
Pan troglodytes ENSPTRG000000119281 retrocopy
Rattus norvegicus ENSRNOG000000044262 retrocopies
Ictidomys tridecemlineatus ENSSTOG000000095665 retrocopies
Tupaia belangeri ENSTBEG0000000462695 retrocopies
retro_tbel_1019, retro_tbel_1022, retro_tbel_1057, retro_tbel_1058, retro_tbel_106, retro_tbel_1081, retro_tbel_1086, retro_tbel_1090, retro_tbel_1134, retro_tbel_1255, retro_tbel_1385, retro_tbel_1403, retro_tbel_1459, retro_tbel_1493, retro_tbel_1565, retro_tbel_1566, retro_tbel_157, retro_tbel_1584, retro_tbel_1606, retro_tbel_1623, retro_tbel_1673, retro_tbel_1678, retro_tbel_1760, retro_tbel_1825, retro_tbel_1863, retro_tbel_1902, retro_tbel_1946, retro_tbel_1952, retro_tbel_2067, retro_tbel_2119, retro_tbel_2122, retro_tbel_2123, retro_tbel_2238, retro_tbel_2354, retro_tbel_2408, retro_tbel_2605, retro_tbel_2671, retro_tbel_2739, retro_tbel_283, retro_tbel_2913, retro_tbel_2939, retro_tbel_2952, retro_tbel_3056, retro_tbel_3119, retro_tbel_3120, retro_tbel_3125, retro_tbel_3180, retro_tbel_3183, retro_tbel_3213, retro_tbel_3258, retro_tbel_3260, retro_tbel_3283, retro_tbel_3389, retro_tbel_3446, retro_tbel_3480, retro_tbel_3481, retro_tbel_3505, retro_tbel_3576, retro_tbel_3595, retro_tbel_3621, retro_tbel_3649, retro_tbel_3665, retro_tbel_3831, retro_tbel_3839, retro_tbel_3840, retro_tbel_3874, retro_tbel_3920, retro_tbel_396, retro_tbel_3977, retro_tbel_4021, retro_tbel_4053, retro_tbel_4133, retro_tbel_4149, retro_tbel_4224, retro_tbel_426, retro_tbel_4284, retro_tbel_4305, retro_tbel_4313, retro_tbel_4474, retro_tbel_4484, retro_tbel_4498, retro_tbel_4499, retro_tbel_4502, retro_tbel_4504, retro_tbel_4547, retro_tbel_4554, retro_tbel_4565, retro_tbel_4628, retro_tbel_703, retro_tbel_709, retro_tbel_763, retro_tbel_843, retro_tbel_866, retro_tbel_871, retro_tbel_874,





Copyright © RetrogeneDB 2014-2017