RetrogeneDB ID:

retro_oniv_8

Retrocopy
location
Organism:Indian wild rice (Oryza nivara)
Coordinates:5:15306740..15308750(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:ONIVA05G14310
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ONIVA01G37420
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_oniv_8
ATGGCGCGCGGCGCAACGTGGACGCGGCGGCTGCACCTGCACGGCCTCTTCCTCGCCGTGCTCCTCCTCCTCACGTTGCC
GGCGGGCTCCACCGCGGCCGCCGGCGGCGGCGGCGGCACCGTGATCGGGATCGACCTCGGCACGACGTACTCGTGCGTCG
GCGTCTACCGGAACGACCGTGTCGAGATCATCGCCAACGACCAGGGGAACCGGATCACACCCTCGTGGGTCGCCTTCACC
GGCGGCGGCGAGCGGCTCATCGGCGAGGCCGCCAAGAACCAGGCGGCGGCGAACCCGGGGCGGACGGTGTACGACGCCAA
GCGCCTCATCGGCCGCCGGTTCGCCGACGCCGAGGTGCAGCGCGACATGAGGCTGCTGCCGTTCGCTGTCGTCGACAAGG
GCGGCAAGCCGCACGTCCGCGTCGAGGTGAGGGGCGGCGACGTGCGGCTGCTCAGCCCCGAGGAGGTGAGCGCCATGGTG
CTCGCCAGGATGAAGGAGACGGCGGAGGCCTACCTCGGGGAGGAGGTCACCCGCGCCGTCGTCACCGTGCCGGCCTACTT
CAACGACGCGCAGCGGCAGGCCACCAAGGACGCCGCCACCATCGCCGGCCTCGCCGTCGAGCGCATCCTCAACGAGCCCA
CCGCCGCCGCGCTCGCCTACGGCGTCGGCAAGGAGGGCGCCGGCGGGAAGAACGTCCTCGTCTTCGACCTCGGCGGCGGC
ACGTTCGACGTCAGCGTCCTCGCCATCGACGGCGGCGTGTACGAGGTCCTCGCCACCAACGGCGACACCCACCTCGGCGG
CGAGGACTTCGACCAGCGCGTCATGGAGCACTTCGTGGAGCTCGTCAGGCGCAAGCACGGCCGCGACATCGCCGGCGACG
CGCGCGCGCTGGGCAAGCTCCGCCGCGAGTGCGAGCGCGCCAAGCGCGCGCTCAGCAGCCAGCACCAGGTGCGCGTCGAG
GTGGAGTCTCTGTTCGACGGCGTCGACCTGTCGGAGCCGCTGTCCAGGGCGCGGTTCGAGGAGCTCAACAACGACCTGTT
CCGGAAGACGATGGCGCCGGTGAGGAAGGCCATGGCGGACGCCAGGCTGAGCAATGCCGACATCGACGAGATCGTCCTCG
TCGGCGGCAGCACGAGGATCCCCAAGGTGAGGCAGCTGCTCAGGGACTACTTCGGCGGCAAGCAGCCCAACCAGGGCGTC
AACCCCGACGAGGCCGTGGCCTACGGCGCCGCCATCCAGGCCAACATCGTCGGCGGCGACACCGACAACAAAACCCGCGA
CATGGTCGTCCTCGACGTCACGCCGCTCACCCTCGGCCTCGAGACCGCCGGCGGCGTCATGGCCACCCTGATCCCGCGCA
ACACGCCGGTGCCGACGAAGAGGGCGCAGCTGTTCTCCACCTACAAGGACAAGCAGACGACGGTGACCGTCAAGGTGTTC
GAGGGCGAGCGGAGCATGACGCGGGACAACCGGCTGCTCGGCAGGTTCGACCTCGCCGGCATCGCGCCGGCGCCGCGCGG
CGCGCCGCAGATCGAGGTGGCGTTCGAGGTGGACGCGGACGGCATCCTCAGCGTGAGCGCCGCCGACAGGGCCACCGGCA
GGTCGGAGAGGATCACCATCTCCGGCGACGACCGCAAGACCAGCCGGGAGGAGATCGACCGGATGGTGGGCGAGGCGGAG
GAGTTCGCCGACGAGGACCGCCGCCACAGGGAGCGCGCCGGCGCCCGGAACAGCCTGGAGGCCTACGTCTACGGCGTCAA
GAACGCCGTGGTGGGCGGCGAGATGGCGGGCGCCACGGACGGCGGCGAGAAGGAGAAGGTGGAGGCGGCGGTGATGGAGG
CGTACGAGTGGCTCGACGGCAACCAGGACGTCGGCAAGGAGGAGTACGAGGAGAAGCTCCGGGAGCTGGAGGACGTGTGC
AACCCGGTCATGTCGGCGGTGTACCAGAGGTCCGGCGGCTCACGGCGAGATGGCGACGGCGGCGGCGACGACGATCACGA
TGAGCTTTAG

ORF - retro_oniv_8 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 69.92 %
Parental protein coverage: 95.19 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalGTVIGIDLGTTYSCVGVYKNGHVEIIANDQGNRITPSWVAFTDS-ERLIGEAAKNQAAVNPERTIFDVKR
GTVIGIDLGTTYSCVGVY.N..VEIIANDQGNRITPSWVAFT...ERLIGEAAKNQAA.NP.RT..D.KR
RetrocopyGTVIGIDLGTTYSCVGVYRNDRVEIIANDQGNRITPSWVAFTGGGERLIGEAAKNQAAANPGRTVYDAKR
ParentalLIGRKFEDKEVQRDMKLVPYKIVNKDGKPYIQVKIKDGENKVFSPEEVSAMILGKMKETAEAYLGKKIND
LIGR.F.D.EVQRDM.L.P...V.K.GKP...V....G.....SPEEVSAM.L..MKETAEAYLG.....
RetrocopyLIGRRFADAEVQRDMRLLPFAVVDKGGKPHVRVEVRGGDVRLLSPEEVSAMVLARMKETAEAYLGEEVTR
ParentalAVVTVPAYFNDAQRQATKDAGVIAGLNVARIINEPTAAAIAYGLDKKG-GEKNILVFDLGGGTFDVSILT
AVVTVPAYFNDAQRQATKDA..IAGL.V.RI.NEPTAAA.AYG..K.G.G.KN.LVFDLGGGTFDVS.L.
RetrocopyAVVTVPAYFNDAQRQATKDAATIAGLAVERILNEPTAAALAYGVGKEGAGGKNVLVFDLGGGTFDVSVLA
ParentalIDNGVFEVLATNGDTHLGGEDFDQRIMEYFIKLIKKKYSKDISKDNRALGKLRREAERAKRALSNQHQVR
ID.GV.EVLATNGDTHLGGEDFDQR.ME.F..L...K...DI..D.RALGKLRRE.ERAKRALS.QHQVR
RetrocopyIDGGVYEVLATNGDTHLGGEDFDQRVMEHFVELVRRKHGRDIAGDARALGKLRRECERAKRALSSQHQVR
ParentalVEIESLFDGTDFSEPLTRARFEELNNDLFRKTMGPVKKAMDDAGLEKSQIHEIVLVGGSTRIPKVQQLLR
VE.ESLFDG.D.SEPL.RARFEELNNDLFRKTM.PV.KAM.DA.L....I.EIVLVGGSTRIPKV.QLLR
RetrocopyVEVESLFDGVDLSEPLSRARFEELNNDLFRKTMAPVRKAMADARLSNADIDEIVLVGGSTRIPKVRQLLR
ParentalDYFEGKEPNKGVNPDEAVAYGAAVQGSILSGEGGDETKDILLLDVAPLTLGIETVGGVMTKLIPRNTVIP
DYF.GK.PN.GVNPDEAVAYGAA.Q..I..G.....T.D...LDV.PLTLG.ET.GGVM..LIPRNT..P
RetrocopyDYFGGKQPNQGVNPDEAVAYGAAIQANIVGGDTDNKTRDMVVLDVTPLTLGLETAGGVMATLIPRNTPVP
ParentalTKKSQVFTTYQDQQTTVSIQVFEGERSMTKDCRLLGKFDLSGIPAAPRGTPQIEVTFEVDANGILNVKAE
TK..Q.F.TY.D.QTTV...VFEGERSMT.D.RLLG.FDL.GI..APRG.PQIEV.FEVDA.GIL.V.A.
RetrocopyTKRAQLFSTYKDKQTTVTVKVFEGERSMTRDNRLLGRFDLAGIAPAPRGAPQIEVAFEVDADGILSVSAA
ParentalDKGTGKSEKITITNEKGRLSQEEIDRMVREAEEFAEEDKKVKERIDARNQLETYVYNMKNTVGDKDKLAD
D..TG.SE.ITI.......S.EEIDRMV.EAEEFA.ED....ER..ARN.LE.YVY..KN.V......A.
RetrocopyDRATGRSERITISGDDRKTSREEIDRMVGEAEEFADEDRRHRERAGARNSLEAYVYGVKNAVVG-GEMAG
ParentalKLESEEKEKVEEALKEALEWLDENQTAEKEEYEEKLKEVEAVCNPIISAVYQRTGGAPGGGADGEGGVDD
.....EKEKVE.A..EA.EWLD.NQ...KEEYEEKL.E.E.VCNP..SAVYQR.GG......DG.GG.DD
RetrocopyATDGGEKEKVEAAVMEAYEWLDGNQDVGKEEYEEKLRELEDVCNPVMSAVYQRSGGS---RRDGDGGGDD
ParentalEHDEL
.HDEL
RetrocopyDHDEL

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza nivara was not studied using RNA-Seq expression data.
Oryza nivara was not studied using ChIP-Seq data.
Oryza nivara was not studied using EST data.
Oryza nivara was not studied using FANTOM5 data.
retro_oniv_8 was not experimentally validated.

Retrocopy orthology:
Oryza nivara does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 8 parental genes, and 8 retrocopies.

Species Parental gene accession Retrocopies number
Brachypodium distachyon BRADI3G014771 retrocopy
Aegilops tauschii F775_274311 retrocopy
Oryza longistaminata KN538684.1_FG0461 retrocopy
Hordeum vulgare MLOC_559991 retrocopy
Oryza nivara ONIVA01G37420 1 retrocopy
retro_oniv_8 ,
Oryza rufipogon ORUFI02G011601 retrocopy
Sorghum bicolor Sb04g0011401 retrocopy
Triticum aestivum Traes_6DS_A593093E11 retrocopy



Copyright © RetrogeneDB 2014-2017