RetrogeneDB ID:

retro_hsap_101

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:4:41983809..41985000(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000182308
Aliases:DCAF4L1, WDR21B
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:DCAF4
Ensembl ID:ENSG00000119599
Aliases:DCAF4, WDR21, WDR21A
Description:DDB1 and CUL4 associated factor 4 [Source:HGNC Symbol;Acc:20229]


Retrocopy-Parental alignment summary:






>retro_hsap_101
ATGGAGGCTGAAAGGCTGCGACTCCTCGAGGAAGAGGCCAAGCTGAAAAAGGTAGCCAGAATGGGATTTAATGCATCTTC
CATGCTCCGAAAAAGCCAGCTAGGTTTCCTCAACGTCACCAGTTACTCCCGTTTAGCCAACGAGCTGCGTGTGAGCTGCA
TGGAGCGGAAAAAGGTCCAAATTCGGAGCTTGGATCCCTCCTCTTTGGCGAGCGACCGATTTAACTTCATTCTGGCGAGT
ACCAACAGCGACCAGCTCTTCGTAGTGAACCAGGTCGAAGTCGAAGGCTCCAAGTACGGCATCATCAGCCTGCGAACTCT
GAAGATCCCTTCGTTCCACGTGTACGTGCTCAGAAACCTCTACGTCCCCAACCGGAAGGTGAAGTCCCTGTGCTGGGCCT
CGCTGAACCAGTTGGACTCTCACGTTCTGCTGTGCTTCGAGGGAATCACAGATGCTCCAAGCTGTGCAGTGCTGCTCCCA
GCGTCGCGGTTCTTAAGTGTTCACACAAGAGTTAACCAGCCTGGCATGCTCTGCAGTTTCCAGATCCCAGAGGCCTGGTC
CTGTGCGTGGTCCCTCAACACCCGGGCATATCACTGCTTTAGTGCAGGCTTGTCTCAGCAGGTCCTGTTGACCAGCGTGG
CGACGGGACACCAGCAGTCATTTGATACCAGCAGTGATGTCTTGGCCCAGCAGTTTGCTAGTACGGCTCCTTTGCTGTTT
AATGGCTGTCGCTCCGGGGAGATCTTTGCCATTGATCTGCGTTGTAGAAATCGAGGCAAGGGGTGGAGGGCCACTCGCCT
GTTCCATGACTCAGCAGTGACCTCTGTGCAAATCCTCCAAGAAGAGCAATGCCTGATGGCATCAGACATGACTGGAAAGA
TCAAGCTGTGGGATCTGAGGGCCACTAAATGTGTAAGGCAGTACGAAGGTCACGTGAATGAGTCCGCCTATCTGCCCCTG
CATGTGCACGAGGAAGAGGGAATCGTGGTGGCAGTGGGCCAGGACTGCTACACGAGAATCTGGAGCCTCCATGATGCCCA
CCTGCTCAGAACCATCCCTTCCCCGTACTCTGCCTCCGAGGACGACATTCCCAGCGTGGCCTTCGCTTCTCGGCTCGGGG
GCATCCGGGGAGCAGCACCAGGGCTGCTCATGGCTGTCCGGCAGGACCTTTATTGTTTCCCCTTCAGCTAA

ORF - retro_hsap_101 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 76.77 %
Parental protein coverage: 79.8 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalMESKRLRLLQEEDRRKKIARMGFNASSMLRKSQLGFLNVTNYCHLAHELRLSCMERKKVQIRSMDPSALA
ME..RLRLL.EE...KK.ARMGFNASSMLRKSQLGFLNVT.Y..LA.ELR.SCMERKKVQIRS.DPS.LA
RetrocopyMEAERLRLLEEEAKLKKVARMGFNASSMLRKSQLGFLNVTSYSRLANELRVSCMERKKVQIRSLDPSSLA
ParentalSDRFNLILADTNSDRLFTVNDVKVGGSKYGIINLQSLKTPTLKVFMHENLYFTNRKVNSVCWASLNHLDS
SDRFN.ILA.TNSD.LF.VN.V.V.GSKYGII.L..LK.P...V....NLY..NRKV.S.CWASLN.LDS
RetrocopySDRFNFILASTNSDQLFVVNQVEVEGSKYGIISLRTLKIPSFHVYVLRNLYVPNRKVKSLCWASLNQLDS
ParentalHILLCLMGLAETPGCATLLPASLFVNSHPGIDRPGMLCSFRIPGAWSCAWSLNIQANNCFSTGLSRRVLL
H.LLC..G....P.CA.LLPAS.F...H.....PGMLCSF.IP.AWSCAWSLN..A..CFS.GLS..VLL
RetrocopyHVLLCFEGITDAPSCAVLLPASRFLSVHTRVNQPGMLCSFQIPEAWSCAWSLNTRAYHCFSAGLSQQVLL
ParentalTNVVTGHRQSFGTNSDVLAQQFALMAPLLFNGCRSGEIFAIDLRCGNQGKGWKATRLFHDSAVTSVRILQ
T.V.TGH.QSF.T.SDVLAQQFA..APLLFNGCRSGEIFAIDLRC.N.GKGW.ATRLFHDSAVTSV.ILQ
RetrocopyTSVATGHQQSFDTSSDVLAQQFASTAPLLFNGCRSGEIFAIDLRCRNRGKGWRATRLFHDSAVTSVQILQ
ParentalDEQYLMASDMAGKIKLWDLRTTKCVRQYEGHVNEYAYLPLHVHEEEGILVAVGQDCYTRIWSLHDARLLR
.EQ.LMASDM.GKIKLWDLR.TKCVRQYEGHVNE.AYLPLHVHEEEGI.VAVGQDCYTRIWSLHDA.LLR
RetrocopyEEQCLMASDMTGKIKLWDLRATKCVRQYEGHVNESAYLPLHVHEEEGIVVAVGQDCYTRIWSLHDAHLLR
ParentalTIPSPYPASKADIPSVAFSSRLGGSRG-APGLLMAVGQDLYCYSYS
TIPSPY.AS..DIPSVAF.SRLGG.RG.APGLLMAV.QDLYC...S
RetrocopyTIPSPYSASEDDIPSVAFASRLGGIRGAAPGLLMAVRQDLYCFPFS

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 0 .18 RPM 6 .06 RPM
bodymap2_adrenal 0 .00 RPM 16 .95 RPM
bodymap2_brain 0 .05 RPM 7 .81 RPM
bodymap2_breast 0 .00 RPM 9 .14 RPM
bodymap2_colon 0 .00 RPM 4 .66 RPM
bodymap2_heart 0 .13 RPM 2 .27 RPM
bodymap2_kidney 0 .29 RPM 9 .27 RPM
bodymap2_liver 0 .00 RPM 4 .06 RPM
bodymap2_lung 0 .11 RPM 4 .83 RPM
bodymap2_lymph_node 0 .37 RPM 5 .57 RPM
bodymap2_ovary 0 .00 RPM 14 .11 RPM
bodymap2_prostate 0 .07 RPM 8 .56 RPM
bodymap2_skeletal_muscle 0 .27 RPM 7 .51 RPM
bodymap2_testis 12 .50 RPM 15 .52 RPM
bodymap2_thyroid 0 .13 RPM 21 .43 RPM
bodymap2_white_blood_cells 0 .00 RPM 5 .06 RPM
RNA Polymerase II activity near the 5' end of retro_hsap_101 was not detected
12 EST(s) were mapped to retro_hsap_101 retrocopy
EST ID Start End Identity Match Mis-match Score
DB061825 41983794 41984345 99.9 550 1 549
DB073896 41983848 41984389 99.3 540 1 538
DB077714 41983791 41984363 100 572 0 572
DB080353 41983772 41984294 100 522 0 522
DB088066 41983790 41984347 97.9 550 7 541
DB093013 41983791 41984341 99.9 549 1 548
DB095626 41983791 41984356 99.9 564 1 563
DB100231 41983712 41984285 99.9 572 1 571
DB448052 41983848 41984276 99.8 426 1 424
HY001456 41983801 41984320 99.7 517 2 515
HY026379 41983801 41984235 99.6 432 2 430
HY053415 41983939 41984503 99.5 557 3 554


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr ≤ 1 1 < Expr ≤ 5 5 < Expr ≤ 10 Expr > 10
TSS #1 TSS_1439561806 libraries 20 libraries 0 libraries 0 libraries 3 libraries

The graphical summary, for retro_hsap_101 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

retro_hsap_101 was not experimentally validated.

Retrocopy orthology:
Retrocopy retro_hsap_101 has 3 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Pan troglodytes retro_ptro_46
Gorilla gorilla retro_ggor_2026
Macaca mulatta retro_mmul_152

Parental genes homology:
Parental genes homology involve 6 parental genes, and 11 retrocopies.

Species Parental gene accession Retrocopies number
Cavia porcellus ENSCPOG000000138781 retrocopy
Homo sapiens ENSG00000119599 2 retrocopies
retro_hsap_101 , retro_hsap_92,
Gorilla gorilla ENSGGOG000000038152 retrocopies
Macaca mulatta ENSMMUG000000036252 retrocopies
Nomascus leucogenys ENSNLEG000000024492 retrocopies
Pan troglodytes ENSPTRG000000065072 retrocopies

Expression level across human populations :

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2089

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2112

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2135

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2158

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2181

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2204

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2227

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2250

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2273

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2296

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2325

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2348

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2371

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2394

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2417

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2440

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2463

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2486

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2509

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2532

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2553

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2576

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2599

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2622

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2645

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2668

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2691

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2714

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2737

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2760

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2787

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2810

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2837

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2860

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2887

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2910

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2937

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2960

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2987

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3010

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3122

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3145

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3168

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3191

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3214

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3241

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3264

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3287

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3310

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3333

Notice: Undefined variable: populLEGEND in /home/retrogenedb/www/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM
Could not execute MySQL populData: