RetrogeneDB ID: | retro_cfam_1013 | ||
Retrocopy location | Organism: | Dog (Canis familiaris) | |
| Coordinates: | 21:25044697..25044907(+) | ||
| Located in intron of: | None | ||
Retrocopy information | Ensembl ID: | None | |
| Aliases: | None | ||
| Status: | NOVEL | ||
Parental gene information | Parental gene summary: | ||
| Parental gene symbol: | HMGN3 | ||
| Ensembl ID: | ENSCAFG00000002809 | ||
| Aliases: | None | ||
| Description: | high mobility group nucleosomal binding domain 3 [Source:HGNC Symbol;Acc:12312] |
Retrocopy-Parental alignment summary:
>retro_cfam_1013
CAGAGAAAGCCTCCAGAGAATACAGAAGACAAGGATAGATCCAAAGCAACTAAATAGGAGACCACCAGACTGTCTGCCAG
ATTGTTAGCAAAACCCACTCCACCAAAACCTGAACCTAAACCAAGAAAAACATCTGCTAACAAAGAACCTGGAACAAAGA
CTAACAAAGGTACCAAAGGAAAGAGGGAGAGCAAGAAGCTGGAAAGCAAG
ORF - retro_cfam_1013 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
| Percent Identity: | 71.43 % |
| Parental protein coverage: | 54.69 % |
| Number of stop codons detected: | 1 |
| Number of frameshifts detected: | 0 |
Retrocopy - Parental Gene Alignment:
| Parental | RNKSPENTEGKDGSKVTKQEPTRRSARLSAKPAPPKPEPKPRKTSAKKEPGTKINKGAKGKKEEKQEAGK |
| ..K.PENTE.KD.SK.TK.E.TR.SARL.AKP.PPKPEPKPRKTSA.KEPGTK.NKG.KGK.E.K....K | |
| Retrocopy | QRKPPENTEDKDRSKATK*ETTRLSARLLAKPTPPKPEPKPRKTSANKEPGTKTNKGTKGKRESKKLESK |
Legend:
| * | Stop codon |
| > | Forward frameshift by one nucleotide |
| < | Reverse frameshift by one nucleotide |
(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)
Expression validation based on RNA-Seq data:
| Library | Retrocopy expression | Parental gene expression |
|---|---|---|
| SRP012049_cerebellum | 0 .00 RPM | 51 .15 RPM |
| SRP017611_brain | 0 .00 RPM | 14 .53 RPM |
| SRP017611_kidney | 0 .00 RPM | 66 .57 RPM |
| SRP017611_liver | 0 .00 RPM | 13 .05 RPM |
Canis familiaris was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_cfam_1013 retrocopy.
Canis familiaris was not studied using FANTOM5 data.
retro_cfam_1013 was not experimentally validated.
Retrocopy orthology:
Retrocopy retro_cfam_1013 has 0 orthologous retrocopies within eutheria group .Parental genes homology:
Parental genes homology involve 8 parental genes, and 10 retrocopies.| Species | Parental gene accession | Retrocopies number | |
|---|---|---|---|
| Ailuropoda melanoleuca | ENSAMEG00000011031 | 1 retrocopy | |
| Bos taurus | ENSBTAG00000001422 | 2 retrocopies | |
| Canis familiaris | ENSCAFG00000002809 | 1 retrocopy |
retro_cfam_1013 ,
|
| Choloepus hoffmanni | ENSCHOG00000007015 | 1 retrocopy | |
| Callithrix jacchus | ENSCJAG00000010800 | 2 retrocopies | |
| Mustela putorius furo | ENSMPUG00000018092 | 1 retrocopy | |
| Otolemur garnettii | ENSOGAG00000016487 | 1 retrocopy | |
| Pongo abelii | ENSPPYG00000016791 | 1 retrocopy |