Parental gene:

VIT_13s0019g03270

Aliases:None
Description:None
Organism:Grape (Vitis vinifera)
Coordinates:13:4328383..4335361(+)


>VIT_13s0019g03270
ATGAAGAATTCCAGCCGATTCTTCACGATCGGCCTCGTCACTGCCTGGTATTCGTCCAACATAGGGGTTTTGTTGCTCAA
CAAGTACTTGCTGAGCAACTATGGCTTCAAGTACCCGATCTTCCTCACCATGTGCCACATGACGGCCTGTTCTTTGCTCA
GCTACGTCGCCATTGCCTGGATGAAGATGGTGCCCATGCAGACCATCCGATCGCGGGTCCAATTCATGAAGATCTCCGCC
CTCAGCCTTGTCTTCTGCGCCTCCGTTGTCAGCGGTAACATTTCCCTTCGCTTTTTGCCGGTTTCATTCAACCAGGCGAT
CGGGGCCACCACGCCGTTTTTCACTGCGGTCTTTGCGTATCTTATGACCTTGAAGAGGGAGGCTTGGCTTACGTATGTTA
CTCTCATTCCCGTTGTCACCGGGGTCATCATCGCAAGCGGGGGTGAACCAAGTTTTCATCTATTTGGGTTTTTAATGTGT
ATTGGTGCTACTGCTGCAAGGGCACTTAAATCAGTGCTTCAAGGGATTCTGCTTTCTTCTGAGGGGGAGAAGCTGAATTC
AATGAACCTGCTTTTATACATGGCTCCTATAGCCGTAGTATTTTTACTTCCTGCCACACTCTTTATGGAAGAAAATGTGG
TTGGTATCACACTAGCACTTGCAAGAGATGATATAAAGATCGTTTGGTATCTGCTATTCAATTCTGCCCTAGCATATTTC
GTAAATTTGACCAATTTTTTGGTCACAAAGCACACGAGTGCCCTAACTCTCCAGGTCCTGGGAAATGCAAAAGGGGCTGT
GGCTGTGGTGGTCTCAATTTTGATCTTTAGAAATCCTGTCTCAGTTACTGGCATGCTAGGTTACTCGCTCACAGTGTTTG
GCGTCATCCTCTACAGTGAGGCAAAGAAGCGAAGCAAATGA

Species Parental gene accession Homology type Retrogenes number
Amborella trichopoda AMTR_s00080p00074790 ortholog_one2many 1 retrogene
Medicago truncatula MTR_3g070000 ortholog_one2one 1 retrogene
Prunus persica PRUPE_ppa009115mg ortholog_one2one 1 retrogene
Theobroma cacao TCM_042615 ortholog_one2one 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_vvin_10 66.67 99.02
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all VIT_13s0019g03270 retrocopies