Parental gene: | ERH, ENSSARG00000005558 |
| Aliases: | None |
| Description: | enhancer of rudimentary homolog (Drosophila) [Source:HGNC Symbol;Acc:3447] |
| Organism: | Shrew (Sorex araneus) |
| Coordinates: | GeneScaffold_1101:75810..99084(-) |
>ENSSARG00000005558
ATGTCTCACACCATTTTACTGGTCCAGCCTACCAAGAGGCCAGAAGGCAGAACTTATGCTGACTATGAATCTGTGAATGA
ATGCATGGAAGGTGTTTGTAAAATGTACGAAGAACATCTGAAGAGAATGAACCCCAATAGCCCCTCTATCACATACGATA
TCAGTCAATTGTTTGATTTTATTGATGATCTGGCAGACCTCAGCTGCCTTGTTTACCGAGCTGATACTCAGACATACCAG
CCTTACAACAAAGACTGGATTAAAGAGAAGATCTACGTGCTTCTTCGTCGGCAGGCCCAGCAGGCCGGGAAATAA
| Species | Parental gene accession | Homology type | Retrogenes number | |
|---|---|---|---|---|
| Callithrix jacchus | ENSCJAG00000014940 | possible_ortholog | 2 retrogenes | |
| Equus caballus | ENSECAG00000019178 | ortholog_one2one | 1 retrogene | |
| Gorilla gorilla | ENSGGOG00000004751 | ortholog_one2one | 2 retrogenes | |
| Microcebus murinus | ENSMICG00000009623 | ortholog_one2one | 1 retrogene | |
| Myotis lucifugus | ENSMLUG00000011879 | possible_ortholog | 1 retrogene | |
| Nomascus leucogenys | ENSNLEG00000001514 | ortholog_one2one | 2 retrogenes | |
| Oryctolagus cuniculus | ENSOCUG00000004636 | possible_ortholog | 1 retrogene | |
| Pan troglodytes | ENSPTRG00000006482 | ortholog_one2one | 2 retrogenes |
| # | RetrogeneDB ID | Identity (%) | Coverage (%) | ORF conservation | Expression evidence | RDV |
|---|---|---|---|---|---|---|
| 1. | retro_sara_56 | 93.33 | 100.00 | Please wait, loading  |
Please wait, loading |
Please wait, loading |
| 2. | retro_sara_58 | 99.04 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 3. | retro_sara_66 | 91.43 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 4. | retro_sara_114 | 91.35 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 5. | retro_sara_127 | 86.27 | 98.08 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 6. | retro_sara_151 | 100.00 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 7. | retro_sara_221 | 99.04 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 8. | retro_sara_251 | 60.42 | 87.50 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 9. | retro_sara_295 | 85.58 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 10. | retro_sara_298 | 75.47 | 100.00 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 11. | retro_sara_490 | 70.45 | 82.69 | Please wait, loading |
Please wait, loading |
Please wait, loading |
Download FASTA sequences of all ENSSARG00000005558 retrocopies