Parental gene: | BLOC1S6, ENSCHOG00000012059 |
| Aliases: | None |
| Description: | biogenesis of lysosomal organelles complex-1, subunit 6, pallidin [Source:HGNC Symbol;Acc:8549] |
| Organism: | Sloth (Choloepus hoffmanni) |
| Coordinates: | GeneScaffold_1518:7911..14632(+) |
>ENSCHOG00000012059
ATGAATGTCCCTGGGCCGCCGCCCCTGGACGGGGTCCTGGCAGGAACCCCTGACGGCCTCGGGGTCGGGGAGACTACTCC
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTACTTTCTCATTATTTGCCAGATCTGCAGAGATCAAAACAAGCCCTCCAGGAACTCACACAAAACCAAGTTGTA
TTATTAGATACACTGGAACAAGAGATTTCAAAATTTAAAGAATGTCATTCTATGTTGGATATTAATGCTTTGTTCACTGA
AGCTAAACACTATCATACCAAGTTGGTGATAAAAGAGATGCTGATGCTTCATGAAAAGACATCAAAGTTAAAAAAAAGAG
CACTTAAACTGCAGCAGAAGAGGCAGAAGGAAGAGTTGGAAAGGGAGCAGCAACGAGAAAAGGAAATTGAAAGAGAAAAG
CAGTTAACTGCCAAACCAGCTAAAAGGACATGA
| Species | Parental gene accession | Homology type | Retrogenes number | |
|---|---|---|---|---|
| Dasypus novemcinctus | ENSDNOG00000019785 | ortholog_one2one | 5 retrogenes | |
| Echinops telfairi | ENSETEG00000007378 | ortholog_one2one | 1 retrogene | |
| Gorilla gorilla | ENSGGOG00000013892 | ortholog_one2one | 1 retrogene | |
| Macropus eugenii | ENSMEUG00000012636 | ortholog_one2many | 1 retrogene | |
| Microcebus murinus | ENSMICG00000005595 | ortholog_one2one | 1 retrogene | |
| Monodelphis domestica | ENSMODG00000017628 | ortholog_one2many | 2 retrogenes | |
| Oryctolagus cuniculus | ENSOCUG00000017351 | ortholog_one2one | 1 retrogene | |
| Otolemur garnettii | ENSOGAG00000013706 | ortholog_one2many | 1 retrogene | |
| Ochotona princeps | ENSOPRG00000007310 | ortholog_one2one | 1 retrogene | |
| Pan troglodytes | ENSPTRG00000007038 | ortholog_one2one | 1 retrogene |
| # | RetrogeneDB ID | Identity (%) | Coverage (%) | ORF conservation | Expression evidence | RDV |
|---|---|---|---|---|---|---|
| 1. | retro_chof_20 | 96.81 | 54.12 | Please wait, loading  |
Please wait, loading |
Please wait, loading |
| 2. | retro_chof_211 | 52.03 | 67.06 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 3. | retro_chof_248 | 77.42 | 67.06 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 4. | retro_chof_600 | 93.97 | 67.06 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 5. | retro_chof_1342 | 76.86 | 67.06 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 6. | retro_chof_2054 | 69.42 | 66.47 | Please wait, loading |
Please wait, loading |
Please wait, loading |
| 7. | retro_chof_2102 | 73.68 | 62.94 | Please wait, loading |
Please wait, loading |
Please wait, loading |
Download FASTA sequences of all ENSCHOG00000012059 retrocopies