RetrogeneDB ID:

retro_oniv_24

Retrocopy
location
Organism:Indian wild rice (Oryza nivara)
Coordinates:1:10240819..10242193(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ONIVA01G12870
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ONIVA06G04710
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_oniv_24
ATGGCCGCCGCCGTCGCCGCCGCCGCCTGCCACTCCCCGGCGCGCCTCGTGGTCACCTGCTCGAGCTCCGCCACGCCCGC
GCCGCCGCGGCGCCCGCTGCGGGTGGCCGTGGTGGGCGGCGGCCCCGCGGGCGCGTCGGCGGCCGAGGCGCTGGCGTCGG
CGGGCGCGCAGGCGTTCCTCCTCGAGCGCAACCCGTCGGGCGCCAAGCCCTGCGGCGGCGCCATCCCGCTCTGCATGCTC
GACGAGTTCGCCATCCCGCGTGACCTCGTCGACCGCCGCGTCACCCGCATGCGCGTCCTCTCGCCGTCCAACCTCGCCGC
CGACTTCTCCCGCGCGCTGCCCCCGGGCGCCCACATCCCCATGCTCCGCCGCGAGGTGCTCGACTCCTTCCTCCGCCGCC
GCGCCGCCGACGCCGGCGCCACCCTCGTCCCGGGCCTCGTCACCTCGCTCTCCCTCCCCGCCGACCCCGCCACCGACCCT
TACCTCGTCCACTACATCTCCTCCGACTCCGGTGGCCCCTCCTCCTCCCGGTGCGTCCTCGAGGTCGACGCCGTCATCGG
CGCGGACGGCGCCAACAGCCGTGTCGCCCGCGAGGTCGGCGCGGGGGACTACTCGACGGCCATCGCGTTCCAGGAGCGCA
TCCGCCTCCCCGACGAGGCCATGGCCTACTACGACGACCTCGCCGAGATGTACGTCGGCGGCGACGTCTCCCCGGACTTC
TACGGCTGGGTCTTCCCCAAGTGCGACCACGTCGCCGTCGGGACGGGCACGGTGGCCGCCAAGCCGGAGATCAAGAGGCT
CCAGTCGGGCATCCGCGCGCGCGCGGCGGGCAAGGTCGCCGGCGGCCGCGTGGTCAGGGTGGAGGCGCACCCGATCCCGG
AGCACCCGCGCCCCCGCCGCGTGGTGGGGCGCGTGGCGCTCGTCGGCGACGCGGCGGGCTACGTCACCCGGTGCTCCGGC
GAGGGCATCTACTTCGCGGCCAGGTCGGGGCGCCTCTGCGGCCGCGCCATGGCCGACGAGTGGCGGCTCACCGGCGCGGT
GACGGAGGCCGGGATACGGGCGGGATACCTCCGGCGGTGGGACGACGAGTTCCGCCCCACGTTCCGGTTCCTGGACCTGC
TGCAGCGGGTGTTCTACGGCGGGAACGCCGGGAGGGAGGCGCTGGTGGAGATGTGCGCCGACGAGCACGTGCAGCGCCGG
ACGTTCGACAGCTACCTGCACAAGCGGATGGCGCCCGCCGAGCCGTGGGGGGACCTCCGCCTGCTGTGGCGCACGGCGGC
GGCCATGGTGCGCTGCGGCGTGCTCGGCAGGGAGGTCGAGCGCCTCCGCCGTCTCGAGCAGCAGGCCGCCGACCAGGTGC
TCCTCCGCCATTGA

ORF - retro_oniv_24 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 57.64 %
Parental protein coverage: 92.87 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalARLVTRAAASSPKLPSGRRLRVAVVGGGPAGGAAAEALAKGGVETVLIERKLDNCKPCGGAIPLCMVSEF
ARLV.....S....P..R.LRVAVVGGGPAG..AAEALA..G....L.ER.....KPCGGAIPLCM..EF
RetrocopyARLVVTCSSSATPAPPRRPLRVAVVGGGPAGASAAEALASAGAQAFLLERNPSGAKPCGGAIPLCMLDEF
ParentalDLPLDLVDRKVRKMKMISPSNVAVDIGGTLAPHEYIGMVRREVLDAYLRSRAEGAGAEVVNGLFLRYEAP
..P.DLVDR.V..M...SPSN.A.D....L.P...I.M.RREVLD..LR.RA..AGA..V.GL......P
RetrocopyAIPRDLVDRRVTRMRVLSPSNLAADFSRALPPGAHIPMLRREVLDSFLRRRAADAGATLVPGLVTSLSLP
ParentalKEP-NGSYVVHYNHYDSSNGKAGGEKRTFEVDAIVGADGANSRVAKDMGAGDYEYAIAFQERVKIPDDKM
..P....Y.VHY...DS..G.........EVDA..GADGANSRVA...GAGDY..AIAFQER...PD..M
RetrocopyADPATDPYLVHYISSDS--GGPSSSRCVLEVDAVIGADGANSRVAREVGAGDYSTAIAFQERIRLPDEAM
ParentalKYYEERAEMYVGDDVSPDFYGWVFPKCDHVAVGTGTVTHKPDIKKFQAATRLRAKDRIEGGKIIRVEAHP
.YY...AEMYVG.DVSPDFYGWVFPKCDHVAVGTGTV..KP.IK..Q...R.RA.....GG...RVEAHP
RetrocopyAYYDDLAEMYVGGDVSPDFYGWVFPKCDHVAVGTGTVAAKPEIKRLQSGIRARAAGKVAGGRVVRVEAHP
ParentalIPEHPRPKRVAGRVTLVGDAAGYVTKCSGEGIYFAAKSGRMCAEAIVAGSANGTRMVEESDLRR-YLAEF
IPEHPRP.RV.GRV.LVGDAAGYVT.CSGEGIYFAA.SGR.C..A..A.....T..V.E...R..YL...
RetrocopyIPEHPRPRRVVGRVALVGDAAGYVTRCSGEGIYFAARSGRLCGRA-MADEWRLTGAVTEAGIRAGYLRRW
ParentalDRLYWPTYKVLDVLQKVFYRSNAAREAFVEMCADDYVQRMTFDSYLYKRVVPGNPLDDIKLAVNTIGSLV
D....PT...LD.LQ.VFY..NA.REA.VEMCAD..VQR.TFDSYL.KR..P..P..D..L...T....V
RetrocopyDDEFRPTFRFLDLLQRVFYGGNAGREALVEMCADEHVQRRTFDSYLHKRMAPAEPWGDLRLLWRTAAAMV
ParentalRATALRREMEKV
R...L.RE.E..
RetrocopyRCGVLGREVERL

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza nivara was not studied using RNA-Seq expression data.
Oryza nivara was not studied using ChIP-Seq data.
Oryza nivara was not studied using EST data.
Oryza nivara was not studied using FANTOM5 data.
retro_oniv_24 was not experimentally validated.

Retrocopy orthology:
Oryza nivara does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 9 parental genes, and 9 retrocopies.

Species Parental gene accession Retrocopies number
Brachypodium distachyon BRADI3G594301 retrocopy
Zea mays GRMZM2G1056441 retrocopy
Oryza meridionalis OMERI02G309801 retrocopy
Oryza nivara ONIVA06G04710 1 retrocopy
retro_oniv_24 ,
Oryza punctata OPUNC02G298601 retrocopy
Oryza rufipogon ORUFI02G340001 retrocopy
Oryza sativa japonicaOS02G07449001 retrocopy
Sorghum bicolor Sb04g0280501 retrocopy
Triticum aestivum Traes_6DL_0FF72D7651 retrocopy



Copyright © RetrogeneDB 2014-2017