Parental gene:

ONIVA06G04710

Aliases:None
Description:None
Organism:Indian wild rice (Oryza nivara)
Coordinates:6:3151617..3153758(-)


>ONIVA06G04710
ATGACCTCGCTGTCGTCCTCCGCCGCCGCGGCGCGCGCCACCTTCGTCATGCCGTCGTCGGTTCGTGGGGGCATGAGCCG
CGGCAGGAGGATGGCGAGGCTGGTGACGCGCGCGGCGGCGTCGAGCCCGAAGCTCCCGAGCGGGCGGCGGCTGCGGGTGG
CGGTGGTCGGAGGCGGACCCGCGGGCGGCGCGGCGGCGGAGGCGCTGGCCAAGGGCGGCGTGGAGACGGTGCTCATCGAA
CGGAAGCTGGACAACTGCAAGCCCTGCGGCGGGGCCATCCCGCTGTGCATGGTGTCGGAGTTCGACCTGCCGCTGGACCT
CGTCGACAGGAAGGTGAGGAAGATGAAGATGATTTCGCCGTCCAACGTCGCCGTCGACATCGGCGGCACGCTCGCGCCGC
ACGAGTACATCGGCATGGTCCGCCGCGAGGTGCTCGACGCCTACCTCCGCTCCCGCGCCGAGGGGGCCGGCGCCGAGGTC
GTCAATGGTCTCTTCCTGAGGTATGAGGCGCCCAAGGAACCCAACGGGTCGTACGTGGTGCACTACAACCACTACGACAG
CTCCAACGGCAAGGCCGGCGGCGAGAAGCGGACGTTCGAGGTGGACGCGATCGTGGGCGCGGACGGCGCCAACTCCCGCG
TCGCCAAGGACATGGGCGCCGGCGACTACGAGTACGCCATCGCGTTCCAGGAGCGCGTCAAGATCCCCGACGACAAGATG
AAGTACTACGAGGAGCGCGCCGAGATGTACGTCGGCGACGACGTCTCGCCGGACTTCTACGGCTGGGTGTTCCCCAAGTG
CGACCACGTCGCCGTCGGCACCGGCACCGTCACCCACAAGCCCGACATCAAGAAGTTCCAGGCCGCCACCCGCCTTCGCG
CCAAGGACCGGATCGAGGGCGGCAAGATCATCCGCGTCGAGGCTCACCCCATCCCCGAGCACCCGAGGCCTAAGAGGGTG
GCGGGGAGGGTGACGCTGGTGGGGGACGCGGCGGGGTACGTGACAAAGTGCTCCGGCGAGGGGATCTACTTCGCGGCGAA
GAGCGGGCGGATGTGCGCGGAGGCGATCGTGGCCGGGTCGGCGAACGGGACGCGGATGGTGGAGGAGAGCGACCTGCGCA
GGTACCTGGCCGAGTTCGACCGCCTCTACTGGCCGACGTACAAGGTGCTCGACGTGCTCCAGAAGGTGTTCTACCGCTCC
AACGCCGCCCGCGAGGCGTTCGTCGAGATGTGCGCCGACGACTACGTCCAGAGGATGACCTTCGACAGCTACCTCTACAA
GCGCGTCGTGCCGGGCAACCCACTCGACGACATCAAGCTCGCCGTCAACACCATCGGCAGCCTCGTCCGCGCCACCGCCC
TCCGCCGCGAGATGGAGAAGGTCACCTTGTGA

Species Parental gene accession Homology type Retrogenes number
Brachypodium distachyon BRADI3G59430 ortholog_one2one 1 retrogene
Zea mays GRMZM2G105644 ortholog_one2one 1 retrogene
Oryza meridionalis OMERI02G30980 ortholog_one2one 1 retrogene
Oryza punctata OPUNC02G29860 ortholog_one2one 1 retrogene
Oryza rufipogon ORUFI02G34000 ortholog_one2one 1 retrogene
Oryza sativa japonica OS02G0744900 ortholog_one2one 1 retrogene
Sorghum bicolor Sb04g028050 ortholog_one2one 1 retrogene
Triticum aestivum Traes_6DL_0FF72D765 ortholog_one2one 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_oniv_24 57.64 92.87
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ONIVA06G04710 retrocopies