RetrogeneDB ID:

retro_oniv_23

Retrocopy
location
Organism:Indian wild rice (Oryza nivara)
Coordinates:12:18121180..18122251(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:ONIVA12G16690
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ONIVA05G19940
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_oniv_23
ATGGCGGAGGTGTGCTGTGATTCTGCGGTGGTGGTCGGGGCGGAGGCGGAGGCGAGGGCGAGGGCGCGCGCCGGGAGGCG
GCGGCGGGCGGGAGTTGAGGGGGCAGGGAGGTGGAACGCCACGGCGACGGCTGCGGGTGTGGCGGCGGAGGAGGCCGCGA
CGAGGAAGCGGAGGGCGAGTGGTGGTGAGGCCGGGTTGGTGGTGGTGGCGAAGCGGCACGGGGCGGCGTCGGTCGCCGGG
AGGAGGAGGGAGATGGAGGACGCCGTGTCGCTGCGCGAGGCGTTCGCCGCGCCGGCGAACGGGGAGGTTGCGGCGGCGAG
GTGTGACTTCTACGGGGTGTTCGACGGGCACGGCTGCTCGCACGTGGCGGACGCGTGCAGGGAGCGGATGCACGAGCTCG
TCGCGGAGGAGATGGGCGCCGGGTCACCGGCGGCGGCGGCGCGCGAGCCGGCGTCTTGGACGGAGACGATGGAGCGGAGC
TTCGCGAGGATGGACGCCGAGGTGATCGCCGGCTGCCGAGCCGAGAGCGGCAGCTGCCGGTGCGAGGGGCAGAAGTGCGA
CCACGTGGGGTCCACCGCGGTGGTGGCCGTCGTGGAGGAGAGCCGCGTCGTCGTCGCCAACTGCGGCGACTCCCGCGCCG
TGCTCTGCCGCGGCGGCGCGCCCGTGCAGCTATCCTCCGACCACAAGCCCGACCGCCCCGACGAGCTGGAGCGGATCGAG
GTGGCCGGCGGCCGCGTCATCTTCTGGGAGGGCGCCCGTGTCCTCGGCGTCCTCGCCATGTCGCGCTCCATCGGCGACGC
CTACCTGAAGCCCTACGTCACCGCCGTGCCGGAGGTGACGGTGACCGGCAGGTCGGACGCCGACGAGTGCCTCATCCTCG
CCAGCGACGGCCTCTGGGACGTCGTCAGCAACGAGGCCGCGTGCGAGGTGGCGCAGTCGTGCCTCCGCCGCGGCAGGCAG
CGGTGGTGCGCCGAGGCGGCGGCGGTGCTGACCAAGCTGGCCCTCGCTCGCCGCAGCTCCGACAACATCTCTGTCGTCGT
CGTCGATCTCCGGCGAGGCAACGCCTTGTAG

ORF - retro_oniv_23 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 59.32 %
Parental protein coverage: 69.71 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalAGVARCGKRQRVA-GARAGAGAATAGPCRPSAGAGFGSRWWPRYGVTSVFGRRREMEDAVSIRPDFL---
AGV...G.....A..A...A..A.....R.S.G.........R.G..SV.GRRREMEDAVS.R..F....
RetrocopyAGVEGAGRWNATATAAGVAAEEAATRKRRASGGEAGLVVVAKRHGAASVAGRRREMEDAVSLREAFAAPA
ParentalRGSTSSGKHHFFGVFDGHGCSHVARMCQDRMHELVVDAYKKAVSGKEAAAAAPA-WKDVMEKGFARMDDE
.G........F.GVFDGHGCSHVA..C..RMHELV............AAA..PA.W...ME..FARMD.E
RetrocopyNGEVAAARCDFYGVFDGHGCSHVADACRERMHELVAE--EMGAGSPAAAAREPASWTETMERSFARMDAE
ParentalATIWAKSRTGGEPACRCELQTPARCDHVGSTAVVAVVGPNRVVVANSGDSRAVLCRAGVPVPLSVDHKPD
.........G....CRCE.Q....CDHVGSTAVVAVV...RVVVAN.GDSRAVLCR.G.PV.LS.DHKPD
RetrocopyVIAGCRAESG---SCRCEGQ---KCDHVGSTAVVAVVEESRVVVANCGDSRAVLCRGGAPVQLSSDHKPD
ParentalRPDELERIKAAGGRVIYWDGARVLGVLAMSRAIGDGYLKPYVTSEPEVTVTERADDDECLILASDGLWDV
RPDELERI..AGGRVI.W.GARVLGVLAMSR.IGD.YLKPYVT..PEVTVT.R.D.DECLILASDGLWDV
RetrocopyRPDELERIEVAGGRVIFWEGARVLGVLAMSRSIGDAYLKPYVTAVPEVTVTGRSDADECLILASDGLWDV
ParentalVTNEMACEVVRACFR
V.NE.ACEV...C.R
RetrocopyVSNEAACEVAQSCLR

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza nivara was not studied using RNA-Seq expression data.
Oryza nivara was not studied using ChIP-Seq data.
Oryza nivara was not studied using EST data.
Oryza nivara was not studied using FANTOM5 data.
retro_oniv_23 was not experimentally validated.

Retrocopy orthology:
Oryza nivara does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 6 parental genes, and 6 retrocopies.

Species Parental gene accession Retrocopies number
Oryza sativa indicaBGIOSGA0179251 retrocopy
Oryza glumaepatula OGLUM05G201501 retrocopy
Oryza meridionalis OMERI05G166001 retrocopy
Oryza nivara ONIVA05G19940 1 retrocopy
retro_oniv_23 ,
Oryza glaberrima ORGLA05G01650001 retrocopy
Oryza rufipogon ORUFI05G202801 retrocopy



Copyright © RetrogeneDB 2014-2017