RetrogeneDB ID:

retro_oniv_16

Retrocopy
location
Organism:Indian wild rice (Oryza nivara)
Coordinates:3:147512..148343(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:ONIVA03G00260
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ONIVA10G20720
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_oniv_16
ATGGTTAGCGGTGATGTAGGAGTAGTAGTGTACTACCTGCTGCTAGTATTAGTGGTGGTGCAGGGGTGCAAAGGCAGCAG
CGCGGTGCAGGGTGAAGGTCGGTGGTACAACGAGAGCGAGGCCATCGGTGGTGCGGCGGCGTGGGGGAACGCGAAGGCGA
CGTGGTACGGGCAGCCGAACGGCGCCGGGGCGGCGGACAACGGCGGGGCGTGCGGGTTCAAGAAGGTGAACCAGTACCCG
TTCATGGGGATGACGTCGTGCGGGAACCAGCCGCTGTACAAGGGCGGCAAGGGCTGCGGCTCCTGCTACCGCGTCAGGTG
CAATCGAAACCCCGCCTGCTCCGGCAACGCCCAGACCGTCGCCATCACCGACATGAACTACTTCCCCCTCTCCCAGTACC
ACTTCGACCTCAGCGGCATCGCCTTCGGCCGCCTCGCCAAGCCCGGCCGCGCCGACGACCTCCGCCGCGCGGGGATCATC
GACGTGCAGTTCGCGCGCGTGCCGTGCGAGTTCCCGGGCCTCAAGGTGGGATTCCACGTGGAGGAAGGGTCCAGCCCCGT
GTACCTGGCGGTGCTGGTGGAGTACGAGAACGGCGACGGAGACGTGGCGCAGGTGGACCTCAAGGAGGCCGGCGCCGGAG
GAGGAAGGTGGACGCCGATGCGGGAGTCGTGGGGGTCGGTGTGGAGGCTGGACTCCAACCACCGCCTGCGGGCGCCATTC
TCCATCCGCATCCGGAGCGACTCCGGCAAGACGTTGGTGGCACCCGACGTCATCCCCCTCAACTGGACGCCCAACACCTT
CTACCGTTCCTTCGTCCAGTACTCCTCCTAG

ORF - retro_oniv_16 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 71.49 %
Parental protein coverage: 87.06 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalGNGVDFNSSDAAVYWGPWTKARATWYGQPNGAGPDDNGGACGFKHTNQYPFMSMTSCGNQPLFKDGKGCG
G.G...N.S.A......W..A.ATWYGQPNGAG..DNGGACGFK..NQYPFM.MTSCGNQPL.K.GKGCG
RetrocopyGEGRWYNESEAIGGAAAWGNAKATWYGQPNGAGAADNGGACGFKKVNQYPFMGMTSCGNQPLYKGGKGCG
ParentalSCYKIRCTKDQSCSGRSETVIITDMNYYPVAPFHFDLSGTAFGRLAKPGLNDKLRHSGIIDIEFTRVPCE
SCY..RC.....CSG...TV.ITDMNY.P....HFDLSG.AFGRLAKPG..D.LR..GIID..F.RVPCE
RetrocopySCYRVRCNRNPACSGNAQTVAITDMNYFPLSQYHFDLSGIAFGRLAKPGRADDLRRAGIIDVQFARVPCE
ParentalFPGLKIGFHVEEYSNPVYFAVLVEYEDGDGDVVQVDLMESKTAHGPPTGRWTPMRESWGSIWRLDTNHRL
FPGLK.GFHVEE.S.PVY.AVLVEYE.GDGDV.QVDL.E.....G...GRWTPMRESWGS.WRLD.NHRL
RetrocopyFPGLKVGFHVEEGSSPVYLAVLVEYENGDGDVAQVDLKEA----GAGGGRWTPMRESWGSVWRLDSNHRL
ParentalQAPFSIRIRNESGKTLVANNVIPANWRPNTFYRSFVQYS
.APFSIRIR..SGKTLVA..VIP.NW.PNTFYRSFVQYS
RetrocopyRAPFSIRIRSDSGKTLVAPDVIPLNWTPNTFYRSFVQYS

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza nivara was not studied using RNA-Seq expression data.
Oryza nivara was not studied using ChIP-Seq data.
Oryza nivara was not studied using EST data.
Oryza nivara was not studied using FANTOM5 data.
retro_oniv_16 was not experimentally validated.

Retrocopy orthology:
Oryza nivara does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 11 parental genes, and 11 retrocopies.

Species Parental gene accession Retrocopies number
Oryza sativa indicaBGIOSGA0334261 retrocopy
Zea mays GRMZM2G0130021 retrocopy
Oryza longistaminata KN539761.1_FG0031 retrocopy
Leersia perrieri LPERR10G140601 retrocopy
Oryza barthii OBART10G181801 retrocopy
Oryza glumaepatula OGLUM10G182901 retrocopy
Oryza nivara ONIVA10G20720 1 retrocopy
retro_oniv_16 ,
Oryza glaberrima ORGLA10G01331001 retrocopy
Oryza rufipogon ORUFI10G193801 retrocopy
Oryza sativa japonicaOS10G05561001 retrocopy
Physcomitrella patens PP1S100_99V61 retrocopy



Copyright © RetrogeneDB 2014-2017