Parental gene:

ONIVA10G20720

Aliases:None
Description:None
Organism:Indian wild rice (Oryza nivara)
Coordinates:10:20496920..20499618(+)


>ONIVA10G20720
ATGGGCTCGCTGTCCTCTCTCGCCGCCGCGGCGGTGTTTCTCTCCCTCCTCGCCGTCGGCCACTGCGCCGCCGCCGACTT
CAACGCCACCGACGCCGACGCCGACTTCGCCGGCAACGGCGTGGACTTCAACTCCAGCGACGCCGCCGTCTACTGGGGCC
CCTGGACCAAGGCCAGGGCCACCTGGTACGGCCAGCCCAACGGCGCCGGCCCCGACGACAACGGCGGCGCGTGCGGGTTC
AAGCACACCAACCAGTACCCGTTCATGTCGATGACCTCCTGCGGCAACCAGCCATTGTTCAAGGACGGCAAGGGATGCGG
CTCTTGCTACAAGATCAGATGCACCAAGGACCAGTCGTGCTCCGGCAGGTCGGAGACGGTGATCATCACCGACATGAACT
ACTACCCGGTGGCTCCGTTCCACTTCGACCTCAGCGGCACGGCGTTCGGCAGGCTCGCCAAGCCTGGCCTCAACGACAAG
CTGCGCCACTCCGGCATCATCGACATCGAGTTCACCAGGGTGCCATGCGAGTTCCCGGGGCTCAAGATCGGGTTCCACGT
GGAGGAGTACTCGAACCCTGTGTACTTCGCGGTGCTGGTGGAGTACGAGGACGGCGACGGCGACGTGGTGCAGGTGGACC
TGATGGAGTCGAAGACGGCGCACGGGCCGCCGACGGGGAGGTGGACGCCGATGAGGGAGTCGTGGGGCTCCATCTGGAGG
CTGGACACCAACCACAGGCTCCAGGCCCCCTTCTCCATCCGCATCCGCAACGAGTCCGGCAAGACGCTCGTCGCCAACAA
CGTCATCCCGGCCAACTGGAGGCCCAACACGTTCTACCGCTCCTTCGTCCAGTACAGCTGA

Species Parental gene accession Homology type Retrogenes number
Oryza sativa indica BGIOSGA033426 ortholog_one2one 1 retrogene
Zea mays GRMZM2G013002 ortholog_one2many 1 retrogene
Oryza longistaminata KN539761.1_FG003 ortholog_one2one 1 retrogene
Leersia perrieri LPERR10G14060 ortholog_one2one 1 retrogene
Oryza barthii OBART10G18180 ortholog_one2one 1 retrogene
Oryza glumaepatula OGLUM10G18290 ortholog_one2one 1 retrogene
Oryza glaberrima ORGLA10G0133100 ortholog_one2one 1 retrogene
Oryza rufipogon ORUFI10G19380 ortholog_one2one 1 retrogene
Oryza sativa japonica OS10G0556100 ortholog_one2one 1 retrogene
Physcomitrella patens PP1S100_99V6 ortholog_many2many 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_oniv_16 71.49 87.06
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ONIVA10G20720 retrocopies