RetrogeneDB ID: | retro_cjac_3133 | ||
Retrocopy location | Organism: | Marmoset (Callithrix jacchus) | |
| Coordinates: | 8:43541657..43541867(-) | ||
| Located in intron of: | None | ||
Retrocopy information | Ensembl ID: | None | |
| Aliases: | None | ||
| Status: | NOVEL | ||
Parental gene information | Parental gene summary: | ||
| Parental gene symbol: | APITD1 | ||
| Ensembl ID: | ENSCJAG00000000135 | ||
| Aliases: | None | ||
| Description: | centromere protein S [Source:RefSeq peptide;Acc:NP_001191857] |
Retrocopy-Parental alignment summary:
>retro_cjac_3133
GAAAATTTCGCCAAAGACCTAGAAATATTTGCAAGACATGCGAAAAGAACCACCATTAACACTGAAGATGTGAAGCTCTT
GCCCAGGAGGAATAATTTACCGCTAAAACACATCACAGACAAAAGTGAAGAGCTTATTCAGATTAACGTAGAACGAAAGA
CACAGAAGAAAAAGAAGATGGAAACAAAAATGCAGAGGTAGAGGGAAGTT
ORF - retro_cjac_3133 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
| Percent Identity: | 72.86 % |
| Parental protein coverage: | 50.72 % |
| Number of stop codons detected: | 1 |
| Number of frameshifts detected: | 0 |
Retrocopy - Parental Gene Alignment:
| Parental | ENFAKDLEMFARHARRTTINTEDVKLLARRSNSLLKYITDKSEEIAQINVERKARKKKKSEDGNHNSREL |
| ENFAKDLE.FARHA.RTTINTEDVKLL.RR.N..LK.ITDKSEE..QINVERK..KKKK.E......RE. | |
| Retrocopy | ENFAKDLEIFARHAKRTTINTEDVKLLPRRNNLPLKHITDKSEELIQINVERKTQKKKKMETKMQR*REV |
Legend:
| * | Stop codon |
| > | Forward frameshift by one nucleotide |
| < | Reverse frameshift by one nucleotide |
(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)
Expression validation based on RNA-Seq data:
| Library | Retrocopy expression | Parental gene expression |
|---|---|---|
| SRP051959_colon | 0 .02 RPM | 1 .84 RPM |
| SRP051959_heart | 0 .00 RPM | 0 .49 RPM |
| SRP051959_kidney | 0 .04 RPM | 0 .47 RPM |
| SRP051959_liver | 0 .00 RPM | 0 .71 RPM |
| SRP051959_lung | 0 .00 RPM | 1 .32 RPM |
| SRP051959_lymph_node | 0 .00 RPM | 2 .58 RPM |
| SRP051959_skeletal_muscle | 0 .00 RPM | 0 .33 RPM |
| SRP051959_spleen | 0 .00 RPM | 1 .79 RPM |
Callithrix jacchus was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_cjac_3133 retrocopy.
Callithrix jacchus was not studied using FANTOM5 data.
retro_cjac_3133 was not experimentally validated.
Retrocopy orthology:
Retrocopy retro_cjac_3133 has 0 orthologous retrocopies within eutheria group .Parental genes homology:
Parental genes homology involve 2 parental genes, and 3 retrocopies.| Species | Parental gene accession | Retrocopies number | |
|---|---|---|---|
| Callithrix jacchus | ENSCJAG00000000135 | 1 retrocopy |
retro_cjac_3133 ,
|
| Otolemur garnettii | ENSOGAG00000011167 | 2 retrocopies |