RetrogeneDB ID: | retro_cjac_3089 | ||
Retrocopy location | Organism: | Marmoset (Callithrix jacchus) | |
| Coordinates: | 8:93771640..93771815(+) | ||
| Located in intron of: | None | ||
Retrocopy information | Ensembl ID: | None | |
| Aliases: | None | ||
| Status: | NOVEL | ||
Parental gene information | Parental gene summary: | ||
| Parental gene symbol: | None | ||
| Ensembl ID: | ENSCJAG00000005592 | ||
| Aliases: | None | ||
| Description: | None |
Retrocopy-Parental alignment summary:
>retro_cjac_3089
GGGTGGGGGTGGGAGAAGGGGGAGGGTGAAGGTAAGGGGTGAGGGAGGGGAAGGGGGTGGGGGTAAGGAAAAGGGAGAAG
AGTGGGGGGAAGGGAAGGGGAGAGGGGAAGGGTAAAGGGAGGGGAGGGAGAAGGGGAAAGAGGGGGAGGGGAAGGGAGAG
GGGGAGGGGAGGAAG
ORF - retro_cjac_3089 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
| Percent Identity: | 51.67 % |
| Parental protein coverage: | 63.44 % |
| Number of stop codons detected: | 1 |
| Number of frameshifts detected: | 1 |
Retrocopy - Parental Gene Alignment:
| Parental | GGEWQEGEEKGEE-EGGEGGGEGEEGEEKEEEGQGQGGGGGPGWEKDKERERKKEKERKK |
| G..W..GE..G...EGGEGGG..E.GEE...EG.G.G.G...G.EK.KE.E.K.E.E..K | |
| Retrocopy | GWGWEKGEGEGKG>EGGEGGGGKEKGEE-WGEGKGRGEG*REGREKGKEGEGKGEGEGRK |
Legend:
| * | Stop codon |
| > | Forward frameshift by one nucleotide |
| < | Reverse frameshift by one nucleotide |
(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)
Expression validation based on RNA-Seq data:
| Library | Retrocopy expression | Parental gene expression |
|---|---|---|
| SRP051959_colon | 0 .00 RPM | 0 .00 RPM |
| SRP051959_heart | 0 .00 RPM | 0 .00 RPM |
| SRP051959_kidney | 0 .00 RPM | 0 .00 RPM |
| SRP051959_liver | 0 .00 RPM | 0 .00 RPM |
| SRP051959_lung | 0 .00 RPM | 0 .00 RPM |
| SRP051959_lymph_node | 0 .00 RPM | 0 .00 RPM |
| SRP051959_skeletal_muscle | 0 .00 RPM | 0 .00 RPM |
| SRP051959_spleen | 0 .00 RPM | 0 .00 RPM |
Callithrix jacchus was not studied using ChIP-Seq data.
No EST(s) were mapped for retro_cjac_3089 retrocopy.
Callithrix jacchus was not studied using FANTOM5 data.
retro_cjac_3089 was not experimentally validated.
Retrocopy orthology:
Retrocopy retro_cjac_3089 has 0 orthologous retrocopies within eutheria group .Parental genes homology:
Parental genes homology involve 1 parental gene, and 1 retrocopy.| Species | Parental gene accession | Retrocopies number | |
|---|---|---|---|
| Callithrix jacchus | ENSCJAG00000005592 | 1 retrocopy |
retro_cjac_3089 ,
|