Parental gene:

SHM3, VIT_04s0008g00770

Aliases:None
Description:None
Organism:Grape (Vitis vinifera)
Coordinates:4:676926..680927(+)


>VIT_04s0008g00770
ATGCAGGCTTGTAGTGGAACTGCTGCTATGGGTTCTCTGCAACAGCCCATTTGGATTAAGGGGTCAAGTTTTGCTCCAAA
TGGGTCTACTGTCAATGGGTTCCCACACCAAATTAAACTGAACTCGGTTAAGCCATGTAGATCTTATATCAAAGGAAGCT
TGGTTACTGGGAAGCCACCTTCCTCTGTGTCTGTCACTGTGCCTGGAAATGGGGATAGTGGAGTCAATTTTATTGACCAT
GGCTTGAATGAAGCTGATCCTGAAGTGTGTGCAATTATTTACAAGGAAAAGCAACGGCAAATGAAAAGCTTAGAACTTAT
TGCCTCAGAGAATTTCACATCCCGGGCAGTGATGGAAGCTGTTGGTTCTTGCCTCACAAACAAATATTCTGAGGGATTGC
CTGGTAAAAGGTACTATGGTGGTAATGAGTTCATTGATGAGCTGGAAACTCTGTGTCAGAAGAGGGCTTTGGCAGCATTC
CACTTAGATGGAAAGAAGTGGGGTGTCAATGTTCAACCATTGTCTGGTTCTCCAGCTAACTTTGAAGTATACACTGCCCT
TCTCAATCCACATGACAGAATCATGGGCTTGGACTTACCTCATGGGGGCCACTTGTCTCATGGTTTCATGACTCCTAAAA
GACGGGTATCAGGCACATCAATTTATTTTGAGTCTATGCCTTATCGACTTGATGAATCTACAGGTCTTGTTGATTATGAC
ATGCTTGAGAAAACAGCTAATCTTTTTCGACCAAAACTCATTATTGCTGGTGCTAGTGCTTATCCTCGAGATTTTGATTA
TCCTCGTATGAGGAAGATTGCAGATGGTGTTGGTGCTTTTCTCATGATGGATATGGCTCACATTAGTGGACTTGTTGCTG
CTTCTGTGGTTGCTGACCCCTTTGAGTACTGTGATATTGTGACAACAACAACACACAAGTCTCTTAGAGGTCCTAGAGGT
GGCATGATCTTCTTCAAGAAAGATTCTGTTCTGGGAGTTGACTTAGAATCTGCCATCAACAATGCTGTTTTTCCAGGTTT
ACAGGGTGGTCCGCATAACCACACAATCGGGGGACTTTCAGTCTGCTTAAAGCATGCCCAATCCCCAGAATTCAAGGCTT
ACCAGAACCAGGTAGTGTCAAACTGTAGAGCTCTTGCTGGCCGGTTAATCGAATTGGGATATAACCTGGTTTCCGGGGGA
AGTGATAACCACCTTATTCTTGTGGATCTTAGGCCATTGGGTATTGATGGGGCTCGGGCGGAGAAGATTCTTGACATGGC
TTCTATCACCCTCAACAAGAATTCAGTGCCTGGCGACAAGAGTGCCCTCGTGCCTGGTGGCATTCGCATCGGATCACCTG
CGATGACTACCAGGGGATTCTCCGAGAAGGAATTCATAGCAACTGCAGATTTCATTCACGAGGGCGTGCAGCTATCTCTT
GAAGCAAAAAAATCGGTTTCAGGATCAAAGCTCCTAGACTTCATGAAGTTTGTAACGTCCCCAGATTTCTCTTTGATAGA
CCGGGTGTCGGATTTGCAGAGGAGAGTCGAAACTCTCACAACCCAGTTCCCAATGCCTGGATTATAA

Species Parental gene accession Homology type Retrogenes number
Solanum tuberosum PGSC0003DMG400029389 ortholog_one2many 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_vvin_49 70.57 52.46
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all VIT_04s0008g00770 retrocopies