Parental gene:

VIT_01s0010g03370

Aliases:None
Description:None
Organism:Grape (Vitis vinifera)
Coordinates:1:20703799..20708466(-)


>VIT_01s0010g03370
ATGGTTATTTCTCATCTCTGCATAAGCTGTCCTTTTTCATATTATATTTCTCAACTTTCCGCCATGGTGAAGTACTCCAG
AGAGCCAGACAATCCCACCAAGTCTTGCAAGGCCAGGGGCTTAGATCTCAGAGTTCACTTCAAGAACACAAGGGAGACTG
CTCATGCCATTAGGAAGTTGCCTTTGGCCAAGGCCAAAAGGTATTTGGAGGATGTTCTGGTCCACAAGCAAGCCATACCT
TTCACCCGCTTCTGTAGAGGTGTTGGACGAACTGCTCAGGCAAAGAACAGGCATTCAAATGGGCAAGGACGCTGGCCTGT
CAAATCTGCTAAATACATCCTAGATTTGCTTAAGAATGCCGAGAGTAATGCTGATTTGAAAGGTCTGGATGTTGATTCAC
TCTACATATCTCACATCCAAGTGAACCAGGCACAGAAACAAAGGCGCCGCACATACCGTGCTCATGGAAGAATCAATCCA
TATATGTCATCCCCATGCCATATCGAGTTGATTTTGTCCGAAAAGGAAGAACCTGTTAAAAAGGAGCCTGAAACTCAGTT
GGCTACCAGCAAGTCCAAGAAGTCTCATGCAGTGCGCGGTGGTGCATCTTCTTGA

Species Parental gene accession Homology type Retrogenes number
Glycine max GLYMA05G27940 ortholog_many2many 1 retrogene
Triticum aestivum Traes_7BS_586D1E6FD ortholog_many2many 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_vvin_18 76.42 60.29
Please wait, loading
Please wait, loading
Please wait, loading
2. retro_vvin_145 80.45 65.20
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all VIT_01s0010g03370 retrocopies