Parental gene:

ONIVA02G27160

Aliases:None
Description:None
Organism:Indian wild rice (Oryza nivara)
Coordinates:2:24467264..24470737(+)


>ONIVA02G27160
ATGGAAATCAAGGACGAGGAGACAACGGCAGAGGTGGCCATGGTGGTGCAGTCGCGGTTCAGAAGGGTATGCGTGTTCTG
TGGGAGCAGCCATGGCAAGAAGAAGATCTACCAGGATGCTGCCATTGAACTTGGGAAGGAGCTGGTGGCAAGAAACATTG
ACCTAGTATATGGAGGAGGGAGTGTAGGGTTGATGGGTTTGGTTTCTCAAGCAGTACACAATGGAGGAAGGCATGTCATT
GGGGTCATTCCCAAGACTCTCATGCCTAGAGAGATATCAGGTGAGACAGTGGGGGAGGTGAAAGCAGTGTCCGATATGCA
CCAGAGGAAGGCTGAGATGGCCAGGCAGTCTGATGCCTTTATAGCATTGCCTGGGGGGTATGGAACACTTGAAGAGCTAC
TAGAAGTAATTGCATGGGCTCAACTTGGAATTCATGACAAACCGGTTGGGCTGCTCAATGTGGATGGCTACTACAATCCG
TTGCTGTCTTTCATCGACAAAGCTGTGGAGGAAGGGTTCATCAGACCTAGTGCCCGCCATATCATCGTCTTGGCCCCAAC
GCCTAAAGAACTCATTGAAAAGCTAGAGGAGTACTCTCCCCAGCACGAGAAAGTCGTGTCAAAGATGAAATGGGAGATGG
AACAGATGAGCTACCCTCAGAACTACGATATCCCCAGGCCAAAGGAGGGAAAGATGATCATAGAAGCACAACGGGGAAGC
AGGCTATGGATGTAA

Species Parental gene accession Homology type Retrogenes number
Oryza sativa indica BGIOSGA008655 ortholog_one2one 1 retrogene
Oryza longistaminata KN538764.1_FG025 ortholog_one2one 1 retrogene
Hordeum vulgare MLOC_6463 ortholog_one2many 1 retrogene
Oryza barthii OBART02G24840 ortholog_one2one 1 retrogene
Oryza rufipogon ORUFI02G26160 ortholog_one2one 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_oniv_19 69.81 86.48
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ONIVA02G27160 retrocopies