Parental gene:

ONIVA01G33130

Aliases:None
Description:None
Organism:Indian wild rice (Oryza nivara)
Coordinates:1:28953754..28958789(+)


>ONIVA01G33130
ATGGCAAGACAAAGCAGCACTGCAGGGGCATCCATACTACCGGTGACGAATATCGGCATGGCCGCCTCCAGAAGCGAGCT
TCTCCGGCCGGCATTCGGCGAGCCCTCTCCTTCGCTAGGACCATTCGTCGTTAACCCTCACACCTGCAGCTACAGGTGGT
GGCAGAAGTTCCTGATCGTGCTGGTGCTGTACACGGCGTGGGCGTCGCCGTTCGAGCTGGCCATGGAGAAGTCGGCCTCG
GCCGCGCTCGCCGTCACGGAGCTGGTGGTCGACGCCTTCTTCGCCGTCGACATTGCCGTCTCCTTCTTCGTGGCGTACCG
CGACGCCTCCACCGGCCTCCTCGTAACCGACCGCAAGAAGATCGCCACCAGACAAGCATTGTATGGGTTCCTCAATCTTC
TCCGGCTCTGGCGACTACGGCGCGTCAGCAAGCTCTTTGCAAGGTTGGAGAAGGACATTAGATTCAGTTACTTGTGGACC
AGGCTTATCAAGCTCCTCTACGTGACGCTGTTCGCAGTGCACTTCGCCTCGTGCATCTACCTGTGGATGGCGTTCCACCA
CAAGGCGAAGGAGCTGACGTGGATCGGCAGCCAGTTCCACGGCTTCGAGGACCGCAGCGTGTGGTTCTGCTACACCTGCG
CCGTGTACTGGTCCATCACCACGCTCGCCACCGTCGGCTACGGCGACCTGCACGCCGCCAACACGGGCGAGATGCTGTTC
AGCATCGCCTTCATGCTCTTCAACATGGGCCTCACCTCCTACATCATCGGCAACATCACCAACCTCGTCGTCCACGAAAC
CACCAACACCTTCAAGATGAGGGACATGGTGCAGAGGACGTCGGTGTTCGGGAGAACGAACCGGCTGCCGGTGGCGATGA
GGGAGCAGATGATGGAAAGCCTGCAGCTCAGGTTCAGGGCGGAGGAGCAGCTGCAGCAGGAGATGCTGTCCGAGCTGCCC
AAGGCCGTGCGGTCAGGCATCGCGCAGCACATGTTCAGGGGGGCGGTCCAGAGCTGCTACCTGTTCCAGGGCGTCTCCGA
CAAGCTCGTCCTGCCGCTGGTCGCGGAGATGAAGGCAGAGTCATTTCCCCCCAAGGCGGATATCATCCTGGAGAACGAGG
CTTCGACGGACTGCTACATCATCGTGTCTGGTGAAGTGGAGGTATTGACAACCCTTGAGGATGGTACAGAGAAGCAAGTG
ATGAGAATAGGGCCACGGGGAATGGCAGGGGAAATTGGGGTGATGTTCAACATCCCACAGCCGTTCACCATCCGGAGCAG
AAAGCTCACGCAGCTCGTCCGTATAAGCCACAGCCATATGGTCTCGACCATCCGGCCTAACACTGCAGATGGGGTCGTTG
TATTCTCCAATTTTGTTCTGTACCTTGAATCTCTGAAGGTGAAGGCAAAGGAAACAGCCTTTGTTAGGGATCATCTTCGC
AATGGCTACTCCACGGTATTAGGAAGTGCAACCATGTTTGATGTAGATGAATCCAAAGAGTCAGCTCACAAAATGTTGCC
ATGCAAAGAACCCAAACGGGTATCTATTCATGAACACCTCTTAAATGGGACTGGCACAGCACTGAACGGCTCATCTGGGA
AGCTCGTCATACTGCCAGATTCTATGCAAGATCTGATGAAACTTTCAGAAAAGAAGTTTGGGAAGGCAGCGAGAGGGATT
CTCACCGTGGGAGGTGCCGAGGTAGAGGACATTGAAGTGATAAGAGATGGCGATCACCTGTTCTTTAGTTGGTAG

Species Parental gene accession Homology type Retrogenes number
Oryza sativa indica BGIOSGA004342 ortholog_one2one 1 retrogene
Oryza brachyantha OB01G37960 ortholog_one2one 1 retrogene
Oryza barthii OBART01G29050 ortholog_one2one 1 retrogene
Oryza glumaepatula OGLUM01G33050 ortholog_one2one 1 retrogene
Oryza rufipogon ORUFI01G32100 ortholog_one2one 1 retrogene
Oryza sativa japonica OS01G0718700 ortholog_one2one 1 retrogene
Setaria italica Si003861m.g ortholog_many2many 1 retrogene

# RetrogeneDB ID Identity (%) Coverage (%) ORF conservation Expression evidence RDV
1. retro_oniv_11 80.00 78.77
Please wait, loading
Please wait, loading
Please wait, loading

Download FASTA sequences of all ONIVA01G33130 retrocopies