RetrogeneDB ID:

retro_oniv_5

Retrocopy
location
Organism:Indian wild rice (Oryza nivara)
Coordinates:8:17919417..17921007(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:ONIVA08G16330
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ONIVA09G08070
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_oniv_5
ATGGCGGCGGCGATGACAATGTGCGCCGCGGTGGCGGTGCTCCTCGTTCTGACGTCGACAATGGCGGCCGCCGCCGGCGA
TGGCGATGGCGATGGCGGTGGCTTCGACTACAAGAAGGCGCTGCACAGCGGGCTGCTCTACTTCGAGGCGCAGCGGTCGG
GGCACCTGCCGTACAACCAGCGGGTGCGGTGGCGCGGCCACTCGGGGCTCGCCGACGGGCTGCAGCAAGGGGTGGACCTC
GTCGGCGGCTACTACGACGCCGGCGACAACGTGAAGTTCGGCCTGCCCATGGCGTTCACGATGACGATGCTGTCGTGGGC
CGCGGCGGAGTTCTGGGACGAGATCGCCGCCGCCGGCGAGCGGCGGCACGTGCTGGAGGCCATCAAGTGGGGCACCGACT
ACCTCGTGAAGGCGCACACCGCCGCCGACGAGCTGTGGGCCGAGGTCGGCGACGGCGACACCGACCACTACTGCTGGCAG
CGGCCGGAGGACATGACGACGTCGAGGCAAGCCTACAAGGTGGACCGCGACAACCCCGGCTCCGACGTCGCCGGCGAGAC
CGCCGCCGCGCTCGCCGCCGCGTCCATCGTGTTCCGCCGCTCCAACCCCCGCTACTCCCGCCTCCTCCTCCGCCACGCCG
AGCAGCTGTTCGACTTCGGCGACAGGTACAGGGGCAAGTACGACAGCAGCATCGGCGAGGTGAGGGCGTACTACGCGTCG
GTGAGCGGCTACGGCGACGAGCTGCTGTGGGCGGCGCTGTGGCTGCACCGCGCCACCGGCCACCGCGGCTACCTCGACTA
CGCCGTCGCCATGGCCGACGAGCTCGGCGGCGTCGGCTGGGCCGTCACCGAGTTCAGCTGGGACGTCAAGTACGCCGGCC
TCCAGATCCTCGCCGCCAAGGTGCTCATGGACGGCGGCGACCACCCGGCGGCGCACGCGGCGACGCTGGAGCAGTACAGG
TCCAAGGCGGAGCACTACCTCTGCGCCTGCCTCGGCAAGAACGCCGCCGCCGGCGACAACGTCAACCGCACCGCCGGCGG
CATGCTGTTCGTCCGCCGCTGGAACAACATGCAGTACGTCACCAACGCCGCCTTCCTCCTCACCGTCTACTCCCGCTACC
TCCGCGACTCCGGCGGCGACACCATCCGGTGCTCCGGTGGGGCTATGGCAACCGGCGACGAGTTGGCGGCGATGGCGAGG
GCGCAGGCGGACTACGTGCTGGGCGACAACCCGGCGGGGGTGAGCTACATGGTCGGGTACGGGCGGCGGTTCCCGCGGCG
GGTGCACCACCGCGGGGCGTCCATGGTGTCGCACCGCGCGGACGGGCGGTTCGTGGGGTGCGTGCAGGGGTACGACCGCT
GGTTCCGGCGCGGCGGCGCGAACCCGAACGTGGTCGCCGGAGCCATCGTCGGCGGGCCGGACGACCGCGACAGGTTCAGG
GACAGCCGCGACAACTACATGCAGACGGAGGCGTGCACGTACAACACCGCGCCCATGGTCGGCGTCTTCGCGCACCTGCA
CGCCCAGAAGATGGCGGCGAGGACTGCTAATAATAATGCCGATCGATCGATGATTAAACGAGTGGATTGA

ORF - retro_oniv_5 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 70.52 %
Parental protein coverage: 93.17 %
Number of stop codons detected: 0
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalLAAVLVLVLLAVVALPLRCDAVSAGGEEEEEQQPLDYREALEKSLLYFEAQRSGRLPYSQRVTWRGHSGL
.AA.........V.L.L......A.G.........DY..AL...LLYFEAQRSG.LPY.QRV.WRGHSGL
RetrocopyMAAAMTMCAAVAVLLVLTSTMAAAAGDGDGDGGGFDYKKALHSGLLYFEAQRSGHLPYNQRVRWRGHSGL
ParentalTDGLQQGVDLVGGYYDAGDHVKFGLPMAFTVTMLSWGAIDFAADIAAAGEWRHALEAIKWGTDYFVKAHT
.DGLQQGVDLVGGYYDAGD.VKFGLPMAFT.TMLSW.A..F...IAAAGE.RH.LEAIKWGTDY.VKAHT
RetrocopyADGLQQGVDLVGGYYDAGDNVKFGLPMAFTMTMLSWAAAEFWDEIAAAGERRHVLEAIKWGTDYLVKAHT
ParentalHPFVYWAEVGDGDTDHYCWQRPEDMTTSRQAYRVDRDNPGSDLAGETAAALAAASIVFRRSDPHYSHLLL
.....WAEVGDGDTDHYCWQRPEDMTTSRQAY.VDRDNPGSD.AGETAAALAAASIVFRRS.P.YS.LLL
RetrocopyAADELWAEVGDGDTDHYCWQRPEDMTTSRQAYKVDRDNPGSDVAGETAAALAAASIVFRRSNPRYSRLLL
ParentalHHAQQLFEFGDTYRGSYDSSIEEVRSYYASVSGYHDELLWAALWLHRATGKEEYLRYAVDNADSFGGVGW
.HA.QLF.FGD.YRG.YDSSI.EVR.YYASVSGY.DELLWAALWLHRATG...YL.YAV..AD..GGVGW
RetrocopyRHAEQLFDFGDRYRGKYDSSIGEVRAYYASVSGYGDELLWAALWLHRATGHRGYLDYAVAMADELGGVGW
ParentalAITEFSWDVKYAGLQVLAAKLLLDGDPQAAAHRGVLEKYREKAEHYLCACLGRNINGADNVDRSPGGMLY
A.TEFSWDVKYAGLQ.LAAK.L.DG....AAH...LE.YR.KAEHYLCACLG.N....DNV.R..GGML.
RetrocopyAVTEFSWDVKYAGLQILAAKVLMDGGDHPAAHAATLEQYRSKAEHYLCACLGKNAAAGDNVNRTAGGMLF
ParentalVRQWNNLQYASSAAFLLTAYSHYLSSSSASASAALRCPSGAAAAA-EMVSLARSQADYILGRNPLRLSYM
VR.WNN.QY...AAFLLT.YS.YL..S........RC..GA.A...E....AR.QADY.LG.NP...SYM
RetrocopyVRRWNNMQYVTNAAFLLTVYSRYLRDSGGD---TIRCSGGAMATGDELAAMARAQADYVLGDNPAGVSYM
ParentalVGYGRRYPARVHHRGASIVSHKEDGRFIGCVQGFDDWFGRGRANPNVLAGAIVGGPSRRDEFRDDRANYM
VGYGRR.P.RVHHRGAS.VSH..DGRF.GCVQG.D.WF.RG.ANPNV.AGAIVGGP..RD.FRD.R.NYM
RetrocopyVGYGRRFPRRVHHRGASMVSHRADGRFVGCVQGYDRWFRRGGANPNVVAGAIVGGPDDRDRFRDSRDNYM
ParentalQTEACTYNTAPMVAVFARLHRLTTAITTA
QTEACTYNTAPMV.VFA.LH....A..TA
RetrocopyQTEACTYNTAPMVGVFAHLHAQKMAARTA

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza nivara was not studied using RNA-Seq expression data.
Oryza nivara was not studied using ChIP-Seq data.
Oryza nivara was not studied using EST data.
Oryza nivara was not studied using FANTOM5 data.
retro_oniv_5 was not experimentally validated.

Retrocopy orthology:
Oryza nivara does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 2 parental genes, and 2 retrocopies.

Species Parental gene accession Retrocopies number
Oryza glumaepatula OGLUM09G094301 retrocopy
Oryza nivara ONIVA09G08070 1 retrocopy
retro_oniv_5 ,



Copyright © RetrogeneDB 2014-2017