RetrogeneDB ID:

retro_oniv_40

Retrocopy
location
Organism:Indian wild rice (Oryza nivara)
Coordinates:11:6384149..6384344(-)
Located in intron of:ONIVA11G07390
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:None
Ensembl ID:ONIVA11G07370
Aliases:None
Description:None


Retrocopy-Parental alignment summary:






>retro_oniv_40
ATGACTGGAAGTGCACCACTTATAATTTTTAGCTGGTTGACATCAGGCATGTGCTTTAGCACAAGTGTCTTCAGGCATGG
GAAAGCCGCCGCGTCAAGAACCAATCTTTTTGCGCTATGCATGTTGTTCAGTCTTAGATAAGTGAGGTTTGACAAATGTG
ATGCAAGCATCGCCAATGGATCCTCTCCAAGATTA

ORF - retro_oniv_40 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 50.77 %
Parental protein coverage: 50.39 %
Number of stop codons detected: 1
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalMTGSASSAIFSRLTFGMSFKTIVFNLGKDPAVMINLFALFMLLSLRVLQLENTKLVIALGQLAHL
MTGSA...IFS.LT.GM.F.T.VF..GK..A...NLFAL.ML.SLR..........IA.G....L
RetrocopyMTGSAPLIIFSWLTSGMCFSTSVFRHGKAAASRTNLFALCMLFSLR*VRFDKCDASIANGSSPRL

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Oryza nivara was not studied using RNA-Seq expression data.
Oryza nivara was not studied using ChIP-Seq data.
Oryza nivara was not studied using EST data.
Oryza nivara was not studied using FANTOM5 data.
retro_oniv_40 was not experimentally validated.

Retrocopy orthology:
Oryza nivara does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 1 parental gene, and 1 retrocopy.

Species Parental gene accession Retrocopies number
Oryza nivara ONIVA11G07370 1 retrocopy
retro_oniv_40 ,



Copyright © RetrogeneDB 2014-2017