pgwin88

789betwin

ufabet

pgwin88

baht89

https://rr.lpsh.net/amp

ufabetwin

https://brss.pattani1.go.th/video/

https://sp.moe.go.th/web_sp_68/book/

https://dol-bangkok.com/video/

ufabetwin

okvip

okvip

https://aicode.cyp.ac.th/video/

max77

RetrogeneDB - Retrocopy retro_hsap_104 details

RetrogeneDB ID:

retro_hsap_104

Retrocopy
location
Organism:Human (Homo sapiens)
Coordinates:2:120979499..120980552(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:ENSG00000226479
Aliases:None
Status:KNOWN_PROTEIN_CODING
Parental gene
information
Parental gene summary:
Parental gene symbol:TMEM185A
Ensembl ID:ENSG00000155984
Aliases:TMEM185A, CXorf13, FAM11A, FRAXF, ee3
Description:transmembrane protein 185A [Source:HGNC Symbol;Acc:17125]


Retrocopy-Parental alignment summary:






>retro_hsap_104
ATGAACCCCAGGGGCCTGTTCCAGGACTTCAACCCCAGTAAGTTTCTCATCTACACCTGCCTGCTGCTCTTCTCGGTGCT
GCTGCCCCTCCGCCTGGACGGCATCATCCAATGGAGCTACTGGGCCGTCTTTGCCCCCATATGGCTGTGGAAGCTTCTAG
TCGTCGCAGGCGCCTCCGTGGGCGCGGGCGTTTGGGCCCGCAACCCTCGCTACCGCACCGAGGGAGAGGCCTGTGTGGAG
TTCAAAGCCATGCTGATCGCTGTGGGCATCCACCTGCTGCTGCTCATGTTCGAAGTCCTGGTCTGCGACAGGGTGGAGAG
GGGCACCCACTTCTGGCTGCTGGTCTTCATGCCTCTCTTCTTCGTGTCCCCCGTGTCCGTGGCTGCCTGCGTCTGGGGCT
TTCGACACGATAGGTCGCTGGAGCTGGAGATCCTGTGCTCGGTCAACATCCTGCAGTTCATCTTCATCGCCCTAAAGCTG
GACAGGATTATTCACTGGCCGTGGCTGGTGGTGTTTGTGCCCCTGTGGATCCTCATGTCGTTCCTTTGCCTGGTCGTCCT
CTATTACATCGTCTGGTCCCTCCTGTTCCTGCGGTCCCTGGATGTGGTTGCCGAGCAGCGGAGAACACACGTGACCATGG
CTATCAGTTGGATAACGATTGTCGTGCCTCTGCTCACTTTTGAGGTCCTGCTGGTTCACAGATTGGATGGCCACAATACA
TTCTCCTACGTCTCCATATTTGTCCCCCTTTGGCTTTCCTTACTAACTTTAATGGCCACAACATTTAGGCGAAAGGGGGG
CAATCATTGGTGGTTTGGCATTCGCAGAGACTTCTGTCAGTTTCTGCTTGAAATTTTCCCATTTTTAAGAGAATATGGGA
ACATTTCATATGATCTCCATCACGAAGATAGTGAAGATGCTGAAGAAACATCAGTTCCAGAAGCTCCGAAAATTGCTCCA
ATATTTGGAAAGAAGGCCAGAGTAGTTATAACCCAGAGCCCTGGGAAATACGTTCCCCCCCCTCCCAAGTTAAATATTGA
TATGCCAGATTAA

ORF - retro_hsap_104 Open Reading Frame is conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 88.57 %
Parental protein coverage: 100.0 %
Number of stop codons detected: 0
Number of frameshifts detected: 0


Retrocopy - Parental Gene Alignment:

ParentalMNLRGLFQDFNPSKFLIYACLLLFSVLLALRLDGIIQWSYWAVFAPIWLWKLMVIVGASVGTGVWARNPQ
MN.RGLFQDFNPSKFLIY.CLLLFSVLL.LRLDGIIQWSYWAVFAPIWLWKL.V..GASVG.GVWARNP.
RetrocopyMNPRGLFQDFNPSKFLIYTCLLLFSVLLPLRLDGIIQWSYWAVFAPIWLWKLLVVAGASVGAGVWARNPR
ParentalYRAEGETCVEFKAMLIAVGIHLLLLMFEVLVCDRIERGSHFWLLVFMPLFFVSPVSVAACVWGFRHDRSL
YR.EGE.CVEFKAMLIAVGIHLLLLMFEVLVCDR.ERG.HFWLLVFMPLFFVSPVSVAACVWGFRHDRSL
RetrocopyYRTEGEACVEFKAMLIAVGIHLLLLMFEVLVCDRVERGTHFWLLVFMPLFFVSPVSVAACVWGFRHDRSL
ParentalELEILCSVNILQFIFIALRLDKIIHWPWLVVCVPLWILMSFLCLVVLYYIVWSVLFLRSMDVIAEQRRTH
ELEILCSVNILQFIFIAL.LD.IIHWPWLVV.VPLWILMSFLCLVVLYYIVWS.LFLRS.DV.AEQRRTH
RetrocopyELEILCSVNILQFIFIALKLDRIIHWPWLVVFVPLWILMSFLCLVVLYYIVWSLLFLRSLDVVAEQRRTH
ParentalITMALSWMTIVVPLLTFEILLVHKLDGHNAFSSIPIFVPLWLSLITLMATTFGQKGGNHWWFGIRKDFCQ
.TMA.SW.TIVVPLLTFE.LLVH.LDGHN.FS...IFVPLWLSL.TLMATTF..KGGNHWWFGIR.DFCQ
RetrocopyVTMAISWITIVVPLLTFEVLLVHRLDGHNTFSYVSIFVPLWLSLLTLMATTFRRKGGNHWWFGIRRDFCQ
ParentalFLLEIFPFLREYGNISYDLHHEDNEETEETPVPEPPKIAPMFRKKARVVITQSPGKYVLPPPKLNIEMPD
FLLEIFPFLREYGNISYDLHHED.E..EET.VPE.PKIAP.F.KKARVVITQSPGKYV.PPPKLNI.MPD
RetrocopyFLLEIFPFLREYGNISYDLHHEDSEDAEETSVPEAPKIAPIFGKKARVVITQSPGKYVPPPPKLNIDMPD

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






(Hint: click retrocopy or parental gene accession number on the plot's legend, to show / hide expression level values)

Expression validation based on RNA-Seq data:
Library Retrocopy expression Parental gene expression
bodymap2_adipose 8 .98 RPM 5 .59 RPM
bodymap2_adrenal 11 .20 RPM 5 .04 RPM
bodymap2_brain 5 .93 RPM 4 .81 RPM
bodymap2_breast 9 .55 RPM 4 .84 RPM
bodymap2_colon 7 .08 RPM 5 .39 RPM
bodymap2_heart 8 .22 RPM 7 .03 RPM
bodymap2_kidney 9 .31 RPM 5 .13 RPM
bodymap2_liver 2 .66 RPM 1 .31 RPM
bodymap2_lung 7 .19 RPM 2 .95 RPM
bodymap2_lymph_node 7 .02 RPM 5 .34 RPM
bodymap2_ovary 12 .11 RPM 10 .26 RPM
bodymap2_prostate 9 .11 RPM 6 .62 RPM
bodymap2_skeletal_muscle 8 .77 RPM 0 .91 RPM
bodymap2_testis 14 .54 RPM 9 .88 RPM
bodymap2_thyroid 12 .69 RPM 6 .89 RPM
bodymap2_white_blood_cells 11 .75 RPM 4 .98 RPM
RNA Polymerase II activity may be related with retro_hsap_104 in 46 libraries
ENCODE library ID Target ChIP-Seq Peak coordinates
ENCFF002CFW POLR2A 2:120980443..120981326
ENCFF002CFX POLR2A 2:120980458..120981320
ENCFF002CGN POLR2A 2:120980622..120981068
ENCFF002CHO POLR2A 2:120980378..120981566
ENCFF002CIH POLR2A 2:120980851..120980999
ENCFF002CIO POLR2A 2:120980595..120981052
ENCFF002CJE POLR2A 2:120980703..120981074
ENCFF002CJZ POLR2A 2:120980716..120981098
ENCFF002CKX POLR2A 2:120980771..120981078
ENCFF002CKX POLR2A 2:120981051..120981202
ENCFF002CLM POLR2A 2:120980641..120981181
ENCFF002CMI POLR2A 2:120980500..120981342
ENCFF002COJ POLR2A 2:120980689..120981125
ENCFF002CPG POLR2A 2:120980647..120981137
ENCFF002CPH POLR2A 2:120980696..120981086
ENCFF002CQA POLR2A 2:120980592..120981162
ENCFF002CQC POLR2A 2:120980681..120981035
ENCFF002CQC POLR2A 2:120980871..120981351
ENCFF002CQE POLR2A 2:120980671..120981075
ENCFF002CQE POLR2A 2:120980994..120981252
ENCFF002CQG POLR2A 2:120980673..120981015
ENCFF002CQI POLR2A 2:120980708..120981059
ENCFF002CQK POLR2A 2:120980608..120981321
ENCFF002CQM POLR2A 2:120980660..120981058
ENCFF002CQO POLR2A 2:120980586..120981072
ENCFF002CRK POLR2A 2:120980908..120981432
ENCFF002CRO POLR2A 2:120980716..120981136
ENCFF002CSY POLR2A 2:120980641..120981163
ENCFF002CUP POLR2A 2:120980763..120981079
ENCFF002CUQ POLR2A 2:120980676..120981180
ENCFF002CVF POLR2A 2:120980709..120981125
ENCFF002CVJ POLR2A 2:120980746..120981054
ENCFF002CXM POLR2A 2:120980643..120981133
ENCFF002CXN POLR2A 2:120980661..120981157
ENCFF002CXO POLR2A 2:120980678..120981102
ENCFF002CXP POLR2A 2:120980752..120981039
ENCFF002CXR POLR2A 2:120980704..120981014
ENCFF002CZC POLR2A 2:120980562..120981123
ENCFF002CZD POLR2A 2:120980584..120981321
ENCFF002DAE POLR2A 2:120980790..120981100
ENCFF002DAE POLR2A 2:120981036..120981346
ENCFF002DAH POLR2A 2:120980797..120981081
ENCFF002DAK POLR2A 2:120980597..120981097
ENCFF002DAV POLR2A 2:120980597..120981141
ENCFF002DBB POLR2A 2:120980834..120981034
ENCFF002DBE POLR2A 2:120980766..120981049
ENCFF002DBO POLR2A 2:120980625..120981079
ENCFF002DBP POLR2A 2:120980771..120981038
ENCFF002DBQ POLR2A 2:120980743..120981113
ENCFF002DBT POLR2A 2:120980748..120981118
5 EST(s) were mapped to retro_hsap_104 retrocopy
EST ID Start End Identity Match Mis-match Score
AA256930 120979906 120980225 100 319 0 319
BE143874 120979779 120980045 99.7 265 1 264
BF349607 120979557 120980049 95.8 470 3 454
BF800502 120979772 120980109 100 336 0 335
HY301666 120979535 120980044 100 509 0 509


TSS No. TSS Name TSS expression level (Expr) in TPM range:
no expression 0 < Expr ≤ 1 1 < Expr ≤ 5 5 < Expr ≤ 10 Expr > 10
TSS #1 TSS_111735686 libraries 811 libraries 315 libraries 14 libraries 3 libraries
TSS #2 TSS_111736114 libraries 127 libraries 1099 libraries 367 libraries 122 libraries
TSS #3 TSS_111737499 libraries 795 libraries 527 libraries 7 libraries 1 library
TSS #4 TSS_11173826 libraries 1 library 30 libraries 173 libraries 1599 libraries

The graphical summary, for retro_hsap_104 TSS expression levels > 0 TPM .
TSS expression levels were studied across 1829 TSS-CAGE libraries, based on FANTOM5 data.
The expression values were visualized using beanplot. If you have any doubts, how to read it, read more in Kampstra P (2008)

Experiment type: PCR amplification
Forward primer: TCGTGCCTCTGCTCACTTTT (20 nt long)
Reverse primer: GCAAAGCCCAAGGAGAGAGT (20 nt long)
Annealing temperature: 56 °C
(Expected) product size: 883
Electrophoresis gel image:
Additional comment: Red arrow indicates PCR product of retrogene in pooled cDNA from 16 human tissues (Clontech). Red number of lane indicates particular retrogene; L - GeneRuler 100 bp DNA Ladder (Thermo Fisher Scientific); N - No template control (water instead of cDNA)

Retrocopy orthology:
Retrocopy retro_hsap_104 has 5 orthologous retrocopies within eutheria group .

Species RetrogeneDB ID
Gorilla gorilla retro_ggor_189
Pongo abelii retro_pabe_118
Macaca mulatta retro_mmul_310
Mus musculus retro_mmus_358
Rattus norvegicus retro_rnor_6

Parental genes homology:
Parental genes homology involve 26 parental genes, and 26 retrocopies.

Species Parental gene accession Retrocopies number
Anolis carolinensis ENSACAG000000086371 retrocopy
Ailuropoda melanoleuca ENSAMEG000000093511 retrocopy
Bos taurus ENSBTAG000000068181 retrocopy
Canis familiaris ENSCAFG000000191031 retrocopy
Cavia porcellus ENSCPOG000000036221 retrocopy
Dasypus novemcinctus ENSDNOG000000118641 retrocopy
Dipodomys ordii ENSDORG000000150271 retrocopy
Equus caballus ENSECAG000000093991 retrocopy
Felis catus ENSFCAG000000244831 retrocopy
Homo sapiens ENSG00000155984 1 retrocopy
retro_hsap_104 ,
Gorilla gorilla ENSGGOG000000242681 retrocopy
Loxodonta africana ENSLAFG000000030441 retrocopy
Microcebus murinus ENSMICG000000046391 retrocopy
Myotis lucifugus ENSMLUG000000013191 retrocopy
Macaca mulatta ENSMMUG000000028881 retrocopy
Mustela putorius furoENSMPUG000000118961 retrocopy
Mus musculus ENSMUSG000000731391 retrocopy
Nomascus leucogenys ENSNLEG000000134871 retrocopy
Otolemur garnettii ENSOGAG000000164141 retrocopy
Procavia capensis ENSPCAG000000091601 retrocopy
Pongo abelii ENSPPYG000000208091 retrocopy
Pteropus vampyrus ENSPVAG000000138221 retrocopy
Rattus norvegicus ENSRNOG000000110471 retrocopy
Sus scrofa ENSSSCG000000127391 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000144841 retrocopy
Tursiops truncatus ENSTTRG000000006431 retrocopy

Expression level across human populations :

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2089

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2112

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2135

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2158

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2181

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2204

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2227

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2250

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2273

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2296

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2325

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2348

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2371

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2394

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2417

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2440

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2463

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2486

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2509

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2532

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2553

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2576

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2599

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2622

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2645

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2668

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2691

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2714

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2737

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2760

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2787

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2810

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2837

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2860

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2887

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2910

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2937

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2960

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 2987

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3010

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3122

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3145

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3168

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3191

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3214

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3241

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3264

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3287

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3310

Notice: Undefined variable: populationsDictCols in /home/retrogenedb/www/retrogene_maps.php on line 3333

Notice: Undefined variable: populLEGEND in /home/retrogenedb/www/retrogene_maps.php on line 3353
image/svg+xml GBR_HG00142 GBR_HG00099 GBR_HG00114 GBR_HG00143 GBR_HG00131 GBR_HG00137 GBR_HG00133 GBR_HG00119 GBR_HG00111 GBR_HG00134 FIN_HG00378 FIN_HG00338 FIN_HG00349 FIN_HG00375 FIN_HG00315 FIN_HG00277 FIN_HG00328 FIN_HG00321 FIN_HG00377 FIN_HG00183 TSI_NA20756 TSI_NA20538 TSI_NA20798 TSI_NA20532 TSI_NA20765 TSI_NA20518 TSI_NA20513 TSI_NA20512 TSI_NA20771 TSI_NA20786 YRI_NA19114 YRI_NA19099 YRI_NA18870 YRI_NA18907 YRI_NA19223 YRI_NA19214 YRI_NA18916 YRI_NA19093 YRI_NA19118 YRI_NA19213 Toscaniin Italia: Finnish inFinland: British in England and Scotland: Utah Residents (CEPH) with Northernand Western European Ancestry: Yoruba in Ibadan, Nigeria: CEU_NA12760 CEU_NA12827 CEU_NA12872 CEU_NA12751 CEU_NA12873 CEU_NA12400 CEU_NA11930 CEU_NA12004 CEU_NA11831 CEU_NA11843



Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3372

Notice: Undefined variable: populationsDict in /home/retrogenedb/www/retrogene_maps.php on line 3375
Library Retrogene expression
CEU_NA11831 0 .00 RPM
CEU_NA11843 0 .00 RPM
CEU_NA11930 0 .00 RPM
CEU_NA12004 0 .00 RPM
CEU_NA12400 0 .00 RPM
CEU_NA12751 0 .00 RPM
CEU_NA12760 0 .00 RPM
CEU_NA12827 0 .00 RPM
CEU_NA12872 0 .00 RPM
CEU_NA12873 0 .00 RPM
FIN_HG00183 0 .00 RPM
FIN_HG00277 0 .00 RPM
FIN_HG00315 0 .00 RPM
FIN_HG00321 0 .00 RPM
FIN_HG00328 0 .00 RPM
FIN_HG00338 0 .00 RPM
FIN_HG00349 0 .00 RPM
FIN_HG00375 0 .00 RPM
FIN_HG00377 0 .00 RPM
FIN_HG00378 0 .00 RPM
GBR_HG00099 0 .00 RPM
GBR_HG00111 0 .00 RPM
GBR_HG00114 0 .00 RPM
GBR_HG00119 0 .00 RPM
GBR_HG00131 0 .00 RPM
GBR_HG00133 0 .00 RPM
GBR_HG00134 0 .00 RPM
GBR_HG00137 0 .00 RPM
GBR_HG00142 0 .00 RPM
GBR_HG00143 0 .00 RPM
TSI_NA20512 0 .00 RPM
TSI_NA20513 0 .00 RPM
TSI_NA20518 0 .00 RPM
TSI_NA20532 0 .00 RPM
TSI_NA20538 0 .00 RPM
TSI_NA20756 0 .00 RPM
TSI_NA20765 0 .00 RPM
TSI_NA20771 0 .00 RPM
TSI_NA20786 0 .00 RPM
TSI_NA20798 0 .00 RPM
YRI_NA18870 0 .00 RPM
YRI_NA18907 0 .00 RPM
YRI_NA18916 0 .00 RPM
YRI_NA19093 0 .00 RPM
YRI_NA19099 0 .00 RPM
YRI_NA19114 0 .00 RPM
YRI_NA19118 0 .00 RPM
YRI_NA19213 0 .00 RPM
YRI_NA19214 0 .00 RPM
YRI_NA19223 0 .00 RPM
Could not execute MySQL populData: