RetrogeneDB ID:

retro_chof_1551

Retrocopy
location
Organism:Sloth (Choloepus hoffmanni)
Coordinates:scaffold_322139:484..814(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:EIF4E
Ensembl ID:ENSCHOG00000009450
Aliases:None
Description:eukaryotic translation initiation factor 4E [Source:HGNC Symbol;Acc:3287]


Retrocopy-Parental alignment summary:






>retro_chof_1551
TGGGTGCTTTGGTTTTTTAAAAATGATAAAAGCAAAACTTGGCAAGCAAACCTTCGACTGATCTCTAAATTTTATACTGT
TGAAGACTTTTGGGCTCTGTACAACCATATCCAGTTGTCTAGTAATTTAATGCCTGGCTGTGACTACTCACTTCTTAAGG
ATGGTATTGAGCCCATGTGGGAAGATGAAAAAAACAAAAGAGGAGGATGATGGCTAATTACATTGAACAAACAGCAGAGA
CGAAGTGACCTTGATCGCTTTTGGCTAGAGACACTGCTGTGCCTTATTGGAGAATCTTTTGATGCCTATAATGACGATGC
ATGTGGAGCC

ORF - retro_chof_1551 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 92.73 %
Parental protein coverage: 62.64 %
Number of stop codons detected: 1
Number of frameshifts detected 0


Retrocopy - Parental Gene Alignment:

ParentalWALWFFKNDKSKTWQANLRLISKFDTVEDFWALYNHIQLSSNLMPGCDYSLFKDGIEPMWEDEKNKRGGR
W.LWFFKNDKSKTWQANLRLISKF.TVEDFWALYNHIQLSSNLMPGCDYSL.KDGIEPMWEDEKNKRGG.
RetrocopyWVLWFFKNDKSKTWQANLRLISKFYTVEDFWALYNHIQLSSNLMPGCDYSLLKDGIEPMWEDEKNKRGG*
ParentalWLITLNKQQRRSDLDRFWLETLLCLIG-SFDDYSDDVCGA
WLITLNKQQRRSDLDRFWLETLLCLIG.SFD.Y.DD.CGA
RetrocopyWLITLNKQQRRSDLDRFWLETLLCLIGESFDAYNDDACGA

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Choloepus hoffmanni was not studied using RNA-Seq expression data.
Choloepus hoffmanni was not studied using ChIP-Seq data.
Choloepus hoffmanni was not studied using EST data.
Choloepus hoffmanni was not studied using FANTOM5 data.
retro_chof_1551 was not experimentally validated.

Retrocopy orthology:
Choloepus hoffmanni does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 28 parental genes, and 91 retrocopies.

Species Parental gene accession Retrocopies number
Bos taurus ENSBTAG000000095223 retrocopies
Canis familiaris ENSCAFG000000103071 retrocopy
Choloepus hoffmanni ENSCHOG00000009450 9 retrocopies
Choloepus hoffmanni ENSCHOG000000131093 retrocopies
Callithrix jacchus ENSCJAG000000071512 retrocopies
Cavia porcellus ENSCPOG000000053834 retrocopies
Dasypus novemcinctus ENSDNOG000000137125 retrocopies
Echinops telfairi ENSETEG000000073473 retrocopies
Homo sapiens ENSG000001512474 retrocopies
Gorilla gorilla ENSGGOG000000047183 retrocopies
Macropus eugenii ENSMEUG000000111043 retrocopies
Microcebus murinus ENSMICG000000014821 retrocopy
Myotis lucifugus ENSMLUG000000050353 retrocopies
Macaca mulatta ENSMMUG000000110662 retrocopies
Monodelphis domestica ENSMODG000000207161 retrocopy
Mustela putorius furoENSMPUG000000020411 retrocopy
Mus musculus ENSMUSG000000281566 retrocopies
Oryctolagus cuniculus ENSOCUG000000014563 retrocopies
Otolemur garnettii ENSOGAG000000011311 retrocopy
Pongo abelii ENSPPYG000000149443 retrocopies
Pan troglodytes ENSPTRG000000163014 retrocopies
Rattus norvegicus ENSRNOG0000001318311 retrocopies
Sorex araneus ENSSARG000000078211 retrocopy
Ictidomys tridecemlineatus ENSSTOG000000022305 retrocopies
Tarsius syrichta ENSTSYG000000108623 retrocopies
Tursiops truncatus ENSTTRG000000042062 retrocopies
Vicugna pacos ENSVPAG000000060723 retrocopies
Drosophila melanogaster FBgn00357091 retrocopy



Copyright © RetrogeneDB 2014-2017