RetrogeneDB ID:

retro_chof_1544

Retrocopy
location
Organism:Sloth (Choloepus hoffmanni)
Coordinates:scaffold_3199:21837..22550(+)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:ATP5B
Ensembl ID:ENSCHOG00000005350
Aliases:None
Description:ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide [Source:HGNC Symbol;Acc:830]


Retrocopy-Parental alignment summary:






>retro_chof_1544
GAATACTTCAGAGATCAAGAAGGTCAAGGTGTACTGCTGTTCATTGATACCATCTTTCGCTTCATCCAGGCTGGCTCAGA
GGTGTCTGCCTTATTGGGCAGAATCCCCTCTGCTGTGGGCTATCAGCCTACCCTGGCCGCTGACATGGGTACCATGCAGG
AAAGAATTACCACCACCAAGAAGGGATCTATCACCTCTGTACAGGCTATCTATGTGCCTGCGGATGACCTGACTGACCCT
GCACCTGCTGCTACCTTTGCCCATTTGAATGCTACCTCTGTGCTGTCCCATGCTATTGCTGAGCTGAGTATCTATCCAGC
TGTGGATCCTCTAGACTCCACCTCTCGCAGCATGGATCCCAGCATTGTTGGCAGTGAACATTATGATGTTGCCGTGGGGT
GCAAAAGATCTTACAGGACTACAGATCCCTTCAGGACATCATTGCAATCTTAGGTATGGATGAACTTTCTGAGGAAGACA
AGTTGACTGTGTCCCATGCACGGAAAATACAGCGTTTCTTGTCTCAGCCATTCCAGGTTGCTGAGGTTTTCACTGGTCAT
TTGGGGAAGCTGGTATCTCTGAACGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGGTGGCTATGACCATCTCCCAGA
ACAAGCCTTCTGTATGGGGGGCTCCATTGAAGAGGCTGTGACAAAAGTGGATAAGCGGGCTGAAGAGCAATCC

ORF - retro_chof_1544 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 88.7 %
Parental protein coverage: 64.84 %
Number of stop codons detected: 0
Number of frameshifts detected 1


Retrocopy - Parental Gene Alignment:

ParentalEYFRDQEGQDVLLFIDNIFRFTQAGSEVSALLGRIPSAVGYQPTLATDMGTMQERITTTKKGSITSVQAI
EYFRDQEGQ.VLLFID.IFRF.QAGSEVSALLGRIPSAVGYQPTLA.DMGTMQERITTTKKGSITSVQAI
RetrocopyEYFRDQEGQGVLLFIDTIFRFIQAGSEVSALLGRIPSAVGYQPTLAADMGTMQERITTTKKGSITSVQAI
ParentalYVPADDLTD-LTATTFAHLDATTVLSRAIAELGIYPAVDPLDSTSRIMDPNIVGSEHYDVA-RGVQKILQ
YVPADDLTD...A.TFAHL.AT.VLS.AIAEL.IYPAVDPLDSTSR.MDP.IVGSEHYDVA.RGVQKILQ
RetrocopyYVPADDLTDPAPAATFAHLNATSVLSHAIAELSIYPAVDPLDSTSRSMDPSIVGSEHYDVA<RGVQKILQ
ParentalDYKSLQDIIAILGMDELSEEDKLTVSRARKIQRFLSQPFQVAEVFTGHLGKLVPLKETIKGFQQILAGDY
DY.SLQDIIAILGMDELSEEDKLTVS.ARKIQRFLSQPFQVAEVFTGHLGKLV.L.ETIKGFQQILAG.Y
RetrocopyDYRSLQDIIAILGMDELSEEDKLTVSHARKIQRFLSQPFQVAEVFTGHLGKLVSLNETIKGFQQILAGGY
ParentalDHLPEQAFYM-GPIEEAVAKADKLAEEHS
DHLPEQAF.M.G.IEEAV.K.DK.AEE.S
RetrocopyDHLPEQAFCMGGSIEEAVTKVDKRAEEQS

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Choloepus hoffmanni was not studied using RNA-Seq expression data.
Choloepus hoffmanni was not studied using ChIP-Seq data.
Choloepus hoffmanni was not studied using EST data.
Choloepus hoffmanni was not studied using FANTOM5 data.
retro_chof_1544 was not experimentally validated.

Retrocopy orthology:
Choloepus hoffmanni does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 17 parental genes, and 25 retrocopies.

Species Parental gene accession Retrocopies number
Anolis carolinensis ENSACAG000000167521 retrocopy
Bos taurus ENSBTAG000000133151 retrocopy
Choloepus hoffmanni ENSCHOG00000005350 1 retrocopy
retro_chof_1544 ,
Callithrix jacchus ENSCJAG000000335712 retrocopies
Dasypus novemcinctus ENSDNOG000000112891 retrocopy
Echinops telfairi ENSETEG000000102081 retrocopy
Homo sapiens ENSG000001109551 retrocopy
Gorilla gorilla ENSGGOG000000115961 retrocopy
Macropus eugenii ENSMEUG000000028756 retrocopies
Microcebus murinus ENSMICG000000010841 retrocopy
Macaca mulatta ENSMMUG000000010271 retrocopy
Pongo abelii ENSPPYG000000046682 retrocopies
Pan troglodytes ENSPTRG000000051071 retrocopy
Sus scrofa ENSSSCG000000004051 retrocopy
Tarsius syrichta ENSTSYG000000099621 retrocopy
Tursiops truncatus ENSTTRG000000021441 retrocopy
Vicugna pacos ENSVPAG000000040252 retrocopies



Copyright © RetrogeneDB 2014-2017