RetrogeneDB ID:

retro_chof_1168

Retrocopy
location
Organism:Sloth (Choloepus hoffmanni)
Coordinates:scaffold_216801:157..608(-)
Located in intron of:None
Retrocopy
information
Ensembl ID:None
Aliases:None
Status:NOVEL
Parental gene
information
Parental gene summary:
Parental gene symbol:RPL7L1
Ensembl ID:ENSCHOG00000000306
Aliases:None
Description:ribosomal protein L7-like 1 [Source:HGNC Symbol;Acc:21370]


Retrocopy-Parental alignment summary:






>retro_chof_1168
ATCAAAGGGATAGGTTTACTGGTGCGGAGGACCATTGAAAGACTTCGCTTGAGAAAGATTTTCAGTGGTATATTTGTGAA
AATGACCCCCACAACCCTAAAAATGCTGTGTACAGTGGAACCTTATGTGATCTGTGGATTTCCAACTCTGAAGTCTGTCA
GGGAACTCATCCTGAAACACGGCAAGCTAAGGTCAAAAATAAGATAATCCCGTTGACAGACAACACAGTAATTGAGGAGC
ACCTGGGGAGATTTGGTGTCATTTGCTTGGAAGATGTCATTCATGAAGTTGCCTTCCCAGGAAGTATTTTGACAGGATCT
CCCAATTCCTGTGCCCATTCTACCTCTAAGTGGACTGTCATGCTACCAAGAATAAAGTGGGCTTTTTCAAGGAAATGGGC
TCACCTGGTTATTGGGGCAAAAGCATCAATCAACTCATCCGACATCTGAAC

ORF - retro_chof_1168 Open Reading Frame is not conserved.
Retrocopy - Parental Gene Alignment summary:
Percent Identity: 88.89 %
Parental protein coverage: 61.38 %
Number of stop codons detected: 1
Number of frameshifts detected 2


Retrocopy - Parental Gene Alignment:

ParentalIKGIGLLMRRTIERLRLRKIFSGVFVKMTPTTLKMLRTVEPYVTWGFPNLKSVRELILKRG-QAKVKNKI
IKGIGLL.RRTIERLRLRKIFSG.FVKMTPTTLKML.TVEPYV..GFP.LKSVRELILK.G.QAKVKNKI
RetrocopyIKGIGLLVRRTIERLRLRKIFSGIFVKMTPTTLKMLCTVEPYVICGFPTLKSVRELILKHG<QAKVKNKI
ParentalIPLTDNTVIEEHLGRFGVICLEDLIHEVAFPG-KYFDRISQFLCPFHLSVARHATKNKVGFFKEMGSPGY
IPLTDNTVIEEHLGRFGVICLED.IHEVAFPG.KYFDRISQFLCPF.L.V..HATKNKVGFFKEMGSPGY
RetrocopyIPLTDNTVIEEHLGRFGVICLEDVIHEVAFPG<KYFDRISQFLCPFYL*VDCHATKNKVGFFKEMGSPGY
ParentalRGESINQLIRQLN
.G.SINQLIR.LN
RetrocopyWGKSINQLIRHLN

Legend:
*Stop codon
>Forward frameshift by one nucleotide
<Reverse frameshift by one nucleotide






Choloepus hoffmanni was not studied using RNA-Seq expression data.
Choloepus hoffmanni was not studied using ChIP-Seq data.
Choloepus hoffmanni was not studied using EST data.
Choloepus hoffmanni was not studied using FANTOM5 data.
retro_chof_1168 was not experimentally validated.

Retrocopy orthology:
Choloepus hoffmanni does not belong to any of the species groups (eutheria, teleost or neognath), studied for retrocopy-based homology. For more information about studied groups, please go to help section.

Parental genes homology:
Parental genes homology involve 30 parental genes, and 175 retrocopies.

Species Parental gene accession Retrocopies number
Ailuropoda melanoleuca ENSAMEG000000127912 retrocopies
Bos taurus ENSBTAG000000184782 retrocopies
Canis familiaris ENSCAFG000000017284 retrocopies
Choloepus hoffmanni ENSCHOG00000000306 4 retrocopies
Cavia porcellus ENSCPOG000000211892 retrocopies
Dasypus novemcinctus ENSDNOG000000134851 retrocopy
Equus caballus ENSECAG000000031131 retrocopy
Erinaceus europaeus ENSEEUG000000104311 retrocopy
Echinops telfairi ENSETEG000000024193 retrocopies
Felis catus ENSFCAG000000097071 retrocopy
Homo sapiens ENSG0000014622322 retrocopies
Gorilla gorilla ENSGGOG0000000995815 retrocopies
Macaca mulatta ENSMMUG000000213131 retrocopy
Monodelphis domestica ENSMODG000000190281 retrocopy
Mustela putorius furoENSMPUG000000132961 retrocopy
Mus musculus ENSMUSG000000638884 retrocopies
Nomascus leucogenys ENSNLEG0000000464921 retrocopies
Oryctolagus cuniculus ENSOCUG000000038446 retrocopies
Otolemur garnettii ENSOGAG000000126713 retrocopies
Pongo abelii ENSPPYG0000001661921 retrocopies
Pan troglodytes ENSPTRG0000001817523 retrocopies
Pteropus vampyrus ENSPVAG000000086963 retrocopies
Rattus norvegicus ENSRNOG000000162691 retrocopy
Sorex araneus ENSSARG000000052862 retrocopies
Sarcophilus harrisii ENSSHAG000000112191 retrocopy
Sus scrofa ENSSSCG000000264723 retrocopies
Ictidomys tridecemlineatus ENSSTOG000000098412 retrocopies
Tarsius syrichta ENSTSYG0000000484816 retrocopies
Tursiops truncatus ENSTTRG000000069716 retrocopies
Vicugna pacos ENSVPAG000000088942 retrocopies



Copyright © RetrogeneDB 2014-2017